1. The only scientific verification we have of probabilities being CONSISTENTLY overcome in a direction where further information is being created is through designed programs. Thus, evolutionary algorithms (which in our experience must be designed with a goal with which to generate and converge information) are one major verification of ID theory.
2. Furthermore, the nature of information processors (no matter their chemical constituents) is such that they can not exist independantly of the information they process, since an information processor is defined in terms of its ability to process information and information is defined as such by its compatible processor -- the two qualities are useless without each other. If evolution is the process which generates information, evolution can not occur before an information storage medium and its compatible processor already exist.
3. Take into account that information is not defined by physical laws of attraction (there is no physical law relating the units within complex specified information) and that information processors convert PRESENT specific coded information into a FUTURE specific goal in the form of function (thus constituting a goal oriented, although NOT necessarily conscious process -- in the same way that computer programs are goal oriented but not conscious), it makes absolutely no logical sense, nor is there any scientific inference or validity in thinking that information and its compatible processor will randomly actualize no matter the chemical reactions by which it is preceeded.
4. The only scientifically verifiable and logical construction of an information processor is accomplished by a previous information processor. Add on to this the fact that the universe is now viewed as a program resulting form a deeper information processor and consciousness may be a result of quantum (sub-natural law) information processing. As stated in point three, there is NO ROOM FOR NATURAL LAWS OF ATTRACTION to create information and there is NO LOGICAL ROOM FOR ACCIDENTAL PROCESSES WHICH ARE NOT DIRECTED to create a goal oriented system such as an information processor.
5. Furthermore, why even bother postulating ACCIDENTAL OCCURENCES for the origination of the first information processor within our universe, when science deals in terms of LAWS of cause and effect? The law of cause and effect that creates information processors are always summed up in terms of laws within a program that results from a previous information processor. IE: computer information processors are caused by mental programs arising from intelligent information processors (the human brain); thus biochemical information processors most likely unfold from the deeper quantum information processor which causes the program of the universe to exist. Now all we need to do is discover how an information processor can be programmed to produce further information/processing systems within its program.
Sunday, April 8, 2007
Subscribe to:
Post Comments (Atom)
10 comments:
1) Who designed any programs to create antibiotic-resistant bacteria outside of a laboratory?
2) Gobbledygook.
3) Once again, simply rank the relative informational contents of genomes of the following cells from a single human being, you (note the important addition of #7):
1) One of your macrophages
2) One of your immature B lymphocytes that has not undergone V(D)J recombination
3) One of your mature B lymphocytes that has undergone V(D)J recombination in one allele, but not the other, and is secreting an antibody against the last rhinovirus that infected you
4) One of your mature B lymphocytes that has undergone V(D)J recombination in both alleles, and is secreting an antibody against the last rhinovirus that infected you
5) One of your mature B lymphocytes that has undergone V(D)J recombination in one allele, but not the other, but makes no functional antibody
6) One of your mature B lymphocytes that has undergone V(D)J recombination in both alleles, but makes no functional antibody.
7) One of your mature B lymphocytes that has undergone V(D)J recombination in both alleles, and is secreting an antibody of unknown specificity.
What is the FUTURE specific goal of this process?
4) "As stated in point three, there is NO ROOM FOR NATURAL LAWS OF ATTRACTION to create information..."
Can you describe the differences between the patterns of snowflakes without imparting any information? Can you reproduce any snowflake pattern without using information?
5) "Furthermore, why even bother postulating ACCIDENTAL OCCURENCES for the creation of information processors..."
No knowledgable person is claiming that natural selection is accidental, AFAIK. This is a classic creationist straw man.
1) The question is not "who" but what phenomenon causes evolutionary programs? All that I have stated in this point is observational data.
To answer your question, the bacteria itself is an intelligent system, which is caused by an evolutionary process which arises from the replicating information processing system known as life, which most likely arises as a programmed result of the quantum information processor which gives rise to our universe.
2)
-then I'm sure you'll be able to provide a counter example.
-or if you are calling "gobbledegook" just because you don't understand the point, then please ask and I will explain to the best of my ability. Start by reading through "definitions" - that may help.
3) no function = no information. Simple as that. Are you saying that there is POSITIVELY no function to these systems or no function that you know of right now?
If there is function, then proceed with Shannon information theory to calculate information content. ie: discover the highest compression of the necessary genetic information possible to cause the function, then proceed to calulate bits of information.
basics of information theory
4) "Can you describe the differences between the patterns of snowflakes without imparting any information? Can you reproduce any snowflake pattern without using information?"
No, there is no way for one intelligent system to represent something to another intelligent system without the use of information. What does this have to do with the fact that INFORMATION IS NOT DEFINED BY PHYSICAL LAWS OF ATTRACTION? Ie: are there any physical laws of attraction between nucleotide bases which causes their sequencing?
5) "No knowledgable person is claiming that natural selection is accidental..."
No knowledgeable person claims that natural selection creates information processors. You have actually just provided a new materialist straw man that I've never even heard before.
"3) no function = no information. Simple as that."
If it's so simple, SIMPLY RANK THEM.
"Are you saying that there is POSITIVELY no function to these systems or no function that you know of right now?"
I'm not saying anything about function. I'm challenging you to quantitate the information in the genomes of these cells from your body.
You said that you could quantitate the information content in a genome. Were you lying?
"If there is function, then proceed with Shannon information theory to calculate information content. ie: discover the highest compression of the necessary genetic information possible to cause the function, then proceed to calulate bits of information."
Then proceed away. What are you afraid of?
"No, there is no way for one intelligent system to represent something to another intelligent system without the use of information."
How would you describe them to an unintelligent system, such as a drawing program on a computer?
"What does this have to do with the fact that INFORMATION IS NOT DEFINED BY PHYSICAL LAWS OF ATTRACTION?"
Everything. The myriad patterns of snowflakes are defined by physical laws of attraction and repulsion between water molecules.
"Ie: are there any physical laws of attraction between nucleotide bases which causes their sequencing?"
This is gibberish, CJYman. Sequencing is what WE do to DNA. If you're saying what I think you're saying, yes. Intra-strand interactions between bases are incredibly important, and clearly constrain the DNA sequences found in nature or constructed in the lab.
DEMBSKI IS WRONG. Either support his claim, if you don't believe me, or deal with it.
"No knowledgeable person claims that natural selection creates information processors."
I claim that mutation (which is only accidental wrt fitness), NS, drift, and a host of other mechanisms create information processors.
You keep using this profoundly dishonest tactic of misrepresenting your opponent's argument, CJYman. This clearly constitutes bearing false witness and is a sin for anyone who claims to be a Christian.
BTW, most of your dishonest misrepresentations of my positions are derived from the fallacy of false dichotomy.
"You have actually just provided a new materialist straw man that I've never even heard before."
You clearly don't know what the term "straw man" means. I am attacking the simple lie, ubiquitous in ID and creationist arguments, that because mutation is random wrt fitness (not wrt location or a host of other characteristics), it is acceptable to claim that all of evolution is "random" or "accidental."
If you cheat at the lottery by hacking the computer to match your already-purchased ticket, would you defend your dishonesty by claiming that your hacking didn't matter, because the number was chosen randomly for your ticket?
3) "no function = no information. Simple as that."
smokey:
"If it's so simple, SIMPLY RANK THEM."
First, I was saying that the DETECTION OF SPECIFIED COMPLEX INFORMATION is simple if the code causes function.
Secondly, my apologies but I do not have the technical experience re: all the relevant genetic information that creates the systems you have mentioned.
But, if you are the same identity from tyharris blog that I am thinking of then, from what I understand, you do have that technical expertise. So, along with an information theoretician you should be able to use the science of information theory to do exactly what you are asking.
Here is the relevant information re: information theory and its application to DNA.
From the conclusion:
"As can be seen in this review, the information theory methods are fully suitable for DNA sequence analysis, in the present state of art. Mainly, it is due to their
ability for handling symbolic sequences.
We thus encourage both information theory and DNA sequence researchers to develop new applications, mainly in the current subject of long-range correlations and compositional patchiness."
Perhaps you could help perform some information theoretic research on DNA. I think that would be quite exciting!!!!!!!!!
smokey:
"You said that you could quantitate the information content in a genome. Were you lying?"
Where did I say that "I", personally, had the relevant expertise with biochemcial systems? However, I seriously think that if you were to give me all of the relevant genetic information of these systems (compressed), I could probably give a basic quantification of the informational content of these systems (if my understanding of the basics of information theory is correct).
Furthermore, it IS still the case that if there is no specific function, then there is no [complex specified] information, which is the type of information that I am discussing in this blog.
CJYman:
"If there is function, then proceed with Shannon information theory to calculate information content. ie: discover the highest compression of the necessary genetic information possible to cause the function, then proceed to calulate bits of information."
smokey:
"Then proceed away. What are you afraid of?"
Why are you imputing emotions in this debate and how is "fear" relevant to this discussion?
smokey:
"How would you describe them [snowflakes] to an unintelligent system, such as a drawing program on a computer?"
Same way as intelligence represents anything. In fact, complex specified information is THE quality which deals with representation (hence the "specified"). (Possibly Conscious) Intelligence describes anything and everything by using information.
But again, "What does this have to do with the fact that INFORMATION IS NOT DEFINED BY PHYSICAL LAWS OF ATTRACTION?"
CJYman:
"What does this have to do with the fact that INFORMATION IS NOT DEFINED BY PHYSICAL LAWS OF ATTRACTION?"
smokey:
"Everything. The myriad patterns of snowflakes are defined by physical laws of attraction and repulsion between water molecules."
Yes, but the patterns on the snowflakes are not ordered by a system into any configuration of specified complex information. A handful of snowflakes creates as much complex specified information as a handful of individual random nucleotide bases. If you read through my definitions, you would see this. The patterns on snowflakes are complex, but not specified. In fact, I wrote the "defintions" section so that I wouldn't have to explain these things a million times over and over again.
My definition can "easily" be destroyed by merely providing a counter-example.
CJYman:
"Ie: are there any physical laws of attraction between nucleotide bases which causes their sequencing?"
smokey:
"This is gibberish, CJYman. Sequencing is what WE do to DNA. If you're saying what I think you're saying, yes. Intra-strand interactions between bases are incredibly important, and clearly constrain the DNA sequences found in nature or constructed in the lab.
DEMBSKI IS WRONG. Either support his claim, if you don't believe me, or deal with it."
Oh dear, where to start. First, I will give you the benefit of the doubt and trust that you are really not understanding what I am saying because I am not explaining myself well enough.
Now, when I refer to "sequencing," I am merely referring to the order in which the units in a "chain" of complex specified information exist.
Let's start with this question: "is the base pair adenine-thymine physically attracted to the base pair guanine-cytosine, thus causing these base pairs to always preceed and follow each other on a strand of DNA?"
CJYman:
"No knowledgeable person claims that natural selection creates information processors."
smokey:
"I claim that mutation (which is only accidental wrt fitness), NS, drift, and a host of other mechanisms create information processors."
For the sake of the present discussion I agree. Now, how do you create an information processor within a system, when there is no preceeding information processor within that system? ID proposes that this must be accomplished in terms of programming by a previous information processor from outside of the system (but I've already discussed this).
smokey:
"I am attacking the simple lie, ubiquitous in ID and creationist arguments, that because mutation is random wrt fitness (not wrt location or a host of other characteristics), it is acceptable to claim that all of evolution is "random" or "accidental.""
Where have I ever said that evolution was random? I actually state the exact opposite. Read "designed to evolve". Is hypocrisy a habit of yours ... stating (falsely at that) that others misrepresent your claim while you do the exact same to them?
I have no problem extending the benefit of the doubt in this conversation if you will not get in the habit of false accusation.
"First, I was saying that the DETECTION OF SPECIFIED COMPLEX INFORMATION is simple if the code causes function."
And I specified the functional differences between the genomes, so that evasion won't work.
"Secondly, my apologies but I do not have the technical experience..."
No technical *experience* would be required. All you'd need is the relevant *knowledge*, all of which is germane to your global claims. IOW, if you weren't bearing false witness with gusto, you could rank these from your armchair; nothing would need to be done in a laboratory.
"... re: all the relevant genetic information that creates the systems you have mentioned."
So I guess that you were lying when you wrote on Ty's blog, "DNA carries information in a very computer-like way, and we can measure the genome’s capacity in bits too, if we wish."
Why did you write that falsehood, if you know so little about how to measure a genome's capacity in bits?
It looks to me as if you are being dishonest, CJYman. If you think that saying something will support your position, you simply claim it. Now, think about the Ten Commandments. As a Christian, aren't you bearing false witness when you make claims about which you have no relevant technical knowledge, much less expertise?
"But, if you are the same identity from tyharris blog that I am thinking of then, from what I understand, you do have that technical expertise."
I am, and I do have technical expertise, but I would never make such a false, ignorant, global claim. It's my knowledge and technical expertise that allows me to spot your, and Dembski's, false claims with ease.
"So, along with an information theoretician you should be able to use the science of information theory to do exactly what you are asking."
I don't think so. Since I'm the only one with relevant expertise among you, me, and your hero Dembski, what does that say about your claim?
"Here is the relevant information re: information theory and its application to DNA."
1) There is hardly any information (data) in the paper.
2) I've never even heard of the journal.
3) It is boring, which is why it wasn't published in a good journal.
4) It is useless unless you can point to someone who USED these methods to tell us something new (generate new data) about the real world.
5) Most importantly, there is nothing in the paper to indicate that your claim is correct, so it supports the hypothesis that you were lying.
"From the conclusion:..."
You didn't even bother reading the paper before citing it, did you? You just assumed that I am as ignorant as you are and would be impressed by the equations and graphs. The paper was so vapid that they devoted a quarter of a page to listing the genetic code, something found in 7th-grade textbooks. Not only that, but the conclusion that you quote-mined says nothing to support your claim.
"Where did I say that "I", personally, had the relevant expertise with biochemcial systems?
When you wrote on Ty's blog, "DNA carries information in a very computer-like way, and we can measure the genome’s capacity in bits too, if we wish."
"However, I seriously think that if you were to give me all of the relevant genetic information of these systems (compressed),..."
Great...except that's exactly what I already did for you, CJYman. I gave you all the relevant genetic (and functional) information describing the differences between the genomes of their cells. Other than those differences, the rest of each genome's the same--all the cells come from you.
"I could probably give a basic quantification of the informational content of these systems (if my understanding of the basics of information theory is correct)."
Then do it! Quit making excuses! Or be an honest Christian and admit that you don't know what you are talking about. You can't even distinguish between data and hypothesis, or data and statistics.
"Why are you imputing emotions in this debate and how is "fear" relevant to this discussion?"
Because emotions explain your irrational behavior. You cite papers that you haven't read, you claim to be able to do things that you can't do, and you try to pretend the Bill Dembski knows something about DNA. When challenged, you run away, but your ego can't resist driving you to claim that you "seriously think" you could do it if I gave you the information that I already gave you!
You don't think seriously about biology.
"Oh dear, where to start. First, I will give you the benefit of the doubt and trust that you are really not understanding what I am saying because I am not explaining myself well enough."
You are explaining yourself well enough so that I can determine that you don't know what you are talking about.
"Now, when I refer to "sequencing," I am merely referring to the order in which the units in a "chain" of complex specified information exist."
That's not what it means to people who talk about DNA on a daily basis, much less people who work with it on a daily basis. If you're going to communicate with people, words have to have a constant meaning, not whatever you want them to mean.
"Let's start with this question: "is the base pair adenine-thymine physically attracted to the base pair guanine-cytosine, thus causing these base pairs to always preceed and follow each other on a strand of DNA?""
No, let's start with the stupid, false statement itself: “In other words, there is complete freedom in the sequencing possibilities of the nucleotide bases.”
Now, to falsify any claim of "complete freedom," all I need is a single case in which the freedom is LESS than complete. IOW, I get to choose, not you. To translate your statement into English, given your ignorant redefinition of "sequencing," you are claiming that there are no constraints on which DNA sequences can exist that are related to bases on the same strand of the DNA. That is so false that it is laughable, because there are many, many sequences that either:
1) exist in one organism but cannot be maintained in another;
2) cannot even be maintained in vitro (i.e., by PCR);
3) or form wild single-stranded (same backbone) secondary structures.
Do you disagree with any of these? If so, supply the data--quotes aren't data, and if you quote anyone, I'll take that as evidence that you lied deliberately.
CJYman:
"No knowledgeable person claims that natural selection creates information processors."
smokey:
"I claim that mutation (which is only accidental wrt fitness), NS, drift, and a host of other mechanisms create information processors."
"For the sake of the present discussion I agree. Now, how do you create an information processor within a system, when there is no preceeding information processor within that system?"
In biology, all the evidence points to variation and selection.
"ID proposes..."
No, ID can't propose anything. You can propose all you want, though. If ID is (or contains) a scientific hypothesis, it makes PREDICTIONS about discrete observations that you or I could make. All your "predictions" that I've looked at so far are bogus, because they are merely restatements of your hypothesis.
"... that this must be accomplished in terms of programming by a previous information processor from outside of the system (but I've already discussed this)."
But you've made no sense, you've redefined important words to mean something different than they really mean, and you've never looked at any relevant data. I hypothesize that you're afraid of data. This hypothesis predicts that you will resort to redefining terms, pointing to arguments instead of data, appeals to unqualified authorities, and quote-mining instead of citing data.
"Where have I ever said that evolution was random?"
When you wrote, "Furthermore, why even bother postulating ACCIDENTAL OCCURENCES for the creation of information processors..."
"I actually state the exact opposite. Read "designed to evolve"."
I read "ACCIDENTAL OCCURENCES" and quoted it. You even capitalized it for emphasis. Now you're saying you didn't mean it, or did you lose track of the premise that I was disputing?
"Is hypocrisy a habit of yours ... stating (falsely at that) that others misrepresent your claim while you do the exact same to them?"
In what way have I misrepresented your claim, "Furthermore, why even bother postulating ACCIDENTAL OCCURENCES for the creation of information processors..."?
Or the ignorant claim, "DNA carries information in a very computer-like way, and we can measure the genome’s capacity in bits too, if we wish," given that, when challenged, you couldn't do it?
Or the even more ignorant claim, “In other words, there is complete freedom in the sequencing possibilities of the nucleotide bases”?
"I have no problem extending the benefit of the doubt in this conversation if you will not get in the habit of false accusation."
In what way have I falsely accused you?
My apologies that this is so long, but you have given me much to reply to, including continued false
accusations of lying.
CJYman:
"First, I was saying that the DETECTION OF SPECIFIED COMPLEX INFORMATION is simple if the code causes function."
smokey:
"And I specified the functional differences between the genomes, so that evasion won't work."
What evasion? ... different function = different information. I’m not understanding your accusation of evasion here.
CJYman:
"Secondly, my apologies but I do not have the technical experience..."
smokey:
"No technical *experience* would be required. All you'd need is the relevant *knowledge*, all of which is germane to your global claims. IOW, if you weren't bearing false witness with gusto, you could rank these from your armchair; nothing would need to be done in a laboratory.
First, just to let you know, I DO appreciate a civil discussion; one that does not impute motives,
emotions, and irrelevant accusations (ie: "you are bearing false witness") that aren’t backed with fact. I would appreciate it if you would continue to engage me here in only civil discussion. Thank you.
Second, I presume that you are aware that in order to calculate information content, a knowledge of
the relevant information structure is necessary. So, I’ve asked for the relevant informational
structure (the sequence of nucleotides) which codes for those systems and you haven’t provided that yet. I’m only asking for that information. Of course, if I did have the technical expertise I’m
guessing I could just go to some data bank on the net, enter in the relevant technical wording, and
find the relevant informational coding for those systems.
Third, are you asking me these questions because, for some reason, you deny that information theory
applies to the information stored in DNA?
CJYman:
"... re: all the relevant genetic information that creates the systems you have mentioned."
smokey:
"So I guess that you were lying when you wrote on Ty's blog, "DNA carries information in a very
computer-like way, and we can measure the genome’s capacity in bits too, if we wish."
Actually, that is a direct quote from Richard Dawkins. Read the whole two para’s that I provided.
IF YOU FALSELY ACCUSE ME OF LYING ONE MORE TIME, I WILL NOT BE ABLE TO CONTINUE THIS DISCUSSION WITH YOU.
smokey:
"Why did you write that falsehood, if you know so little about how to measure a genome's
capacity in bits?
It looks to me as if you are being dishonest, CJYman. If you think that saying something will
support your position, you simply claim it. Now, think about the Ten Commandments. As a Christian, aren't you bearing false witness when you make claims about which you have no relevant technical knowledge, much less expertise?"
Ummm ... yep, I checked it out and you’ve talked yourself into a bad case of mistaken identity. That quote did not originate from me. You have just falsely accussed me of lying.
If you would have actually read the full two para that I copied and went to the link I provided, you
would have noticed that I quoted Richard Dawkins because he gives an easy to understand explanation of information and its relation to the genome.
Why do you seem so desperate to accuse me of lying? So desperate in fact, that you don’t read
where I said that I was about to quote Richard Dawkins.
CJYman:
"So, along with an information theoretician you should be able to use the science of information
theory to do exactly what you are asking."
smokey:
"I don't think so. Since I'm the only one with relevant expertise among you, me, and your hero
Dembski, what does that say about your claim?"
Which claim? The one that “information is not defined by physical laws of attraction” – the one that you keep dancing around and haven’t addressed yet? Or are you referring to Dr. Dawkin’s
claim that we can measure the genome’s capacity in bits, and my claim that I’m pretty sure that I could provide the number of bits of a given sequence of functional nucleotides if you would provide the sequence?
Actually, since you aren’t giving me any genetic information, I’ll just find some myself and tell you
how many bits it contains.
-protein: "CLATHRIN HEAVY CHAIN PROXIMAL LEG SEGMENT (BOVINE)"
-nucleotide sequence which codes for the structure of the protein:
CTTGCTGAACTTGAAGAATTTATTAATTATGATGCTGCTAAACTTCTTTATAATAATGTT
TCTTTTGGTCGTCTTGCTTCTACTCTTGTTCATCTTGGTTATCAAGCTGCTGTTGATGGT
GCTCGTAAAGCTAATACTCGTACTTGGAAAGAAGTTTGTTTTGCTTGTGTTGATGGTAAA
TTTCGTCTTGCTCAAATGTGTGGTCTTCATATTGTTGTTGCTGATGAACTTGAAGAACTT
ATTAATTATTATCAAGATCGTGGTTTTGAAGAACTTATTACTATGCTTGAAGCTGCTCTT
GGTCTTGAACGTATGGGTATGTTTACTGAACTTGCTATTCTTTATTCTAAATTTCCTCAA
AAAATGCGTGAACATCTTGAACTTTTTTGGTCTCGTGTTATTCCTAAAGTTCTTCGTGCT
... etc (there's more but I'm getting tired of cut and paste)
-bits of information: 1722 bits
And yes, since you do have the relevant experience, together with an information theoretician, you
WILL be able to begin to calculate the informational content of those systems which you named.
Furthermore, you should add Dr.s Trevors, Abel, Voie, and Yockey to my list of “heroes” in this
discussion, along with Dr. Dembski. But, naming each other’s “heroes” doesn’t seem to add to this
discussion.
CJYman:
"Here is the relevant information re: information theory and its application to DNA."
smokey:
"1) There is hardly any information (data) in the paper.
2) I've never even heard of the journal.
3) It is boring, which is why it wasn't published in a good journal.
4) It is useless unless you can point to someone who USED these methods to tell us something new
(generate new data) about the real world.
5) Most importantly, there is nothing in the paper to indicate that your claim is correct, so it supports
the hypothesis that you were lying.
You didn't even bother reading the paper before citing it, did you? You just assumed that I am as
ignorant as you are and would be impressed by the equations and graphs. The paper was so vapid
that they devoted a quarter of a page to listing the genetic code, something found in 7th-grade
textbooks. Not only that, but the conclusion that you quote-mined says nothing to support your
claim."
Actually I did read through the paper, and yes SOME of it was quite basic ... it was a basic
description of the genetic code and how information theory is applied, along with some more complicated equations. From my understanding it is restating those two paragraphs I quoted from Richard Dawkins (regarding information theory and the genome) with the relevant mathematics from information theory.
1) There is enough information (data) to show some of the basic math behind information theory and
its relation to the genetic code. I will admit that I don’t understand all of the math, but if any of it is incorrect, I’m sure you or an information theoretician will be gracious enough to point me in the right direction to a paper (obviously in a prestigious journal) which shows the irrelevance of information theory to the genetic code.
2)Uhuh, and ... ?!?!?!?
3) An amazingly thought provocative point ... “the article was boring.” My apologies, can you please discuss with me what you find exciting so that from now on I can only reference “exciting articles.”
4) Sure, no problem, the application of information theory to biology shows us something new
about the world – that life is an informational system, and can be studied as such. Furthermore, part
2 in the book, "Information theory and molecular biology" by Hubert Yockey discusses application of information theory to problems in molecular biology.
Shown in this review
As to “not supporting my claim” ... depends on which claim you are talking about. The only reason I posted this example is to show the relevance of information theory to the genome, which I initially presumed that a man of your expertise would already be aware of.
Furthermore, if that paper wasn’t “good enough” for you, just search through the Journal of Theoretical Biology (as I have done), and you’ll find some relevant information, or we could discuss the basics of information theory and continue to learn together. Or I could provide you with some links to some relevant articles that were published in the Journal of Theoretical Biology if you so desire.
CJYman:
"Where did I say that "I", personally, had the relevant expertise with biochemcial systems?"
smokey:
"When you wrote on Ty's blog, "DNA carries information in a very computer-like way, and we can
measure the genome’s capacity in bits too, if we wish."
Richard Dawkins said that. I quoted him and was careful to give him the credit for the statements
that he made. Now I would appreciate the same attention to detail from yourself. Are you denying this statement of Dawkins’? If so, I’m fine with discussing it.
CJYman:
"However, I seriously think that if you were to give me all of the relevant genetic information of
these systems (compressed),..."
smokey:
"Great...except that's exactly what I already did for you, CJYman. I gave you all the relevant
genetic (and functional) information describing the differences between the genomes of their cells. Other than those differences, the rest of each genome's the same--all the cells come from you."
I must have missed that somewhere then, ‘cause I didn’t seem to receive any of the genetic information from you. By genetic information, you do mean the sequence of nucleotides, correct?
CJYman:
"Why are you imputing emotions in this debate and how is "fear" relevant to this discussion?"
smokey:
"Because emotions explain your irrational behavior. You cite papers that you haven't read, you
claim to be able to do things that you can't do, and you try to pretend the Bill Dembski knows
something about DNA. When challenged, you run away, but your ego can't resist driving you to
claim that you "seriously think" you could do it if I gave you the information that I already gave
you!"
Can you please show me where I have behaved irrationally, where I have cited a paper that I didn’t read, and where I have claimed to do things that I can’t do?
Dr. Dembski knows something about information theory and if DNA is an information carrying molecule, then he will know the relevant application of information theory to DNA. However, the point of his that you continue to bring up here is irrelevant to my 5 point summary which is the topic of this thread.
Run away?!?!?! um ... riiiiight ... and where’s the genetic information you said you would supply?
Again, why are you imputing motive in this discussion and how is “fear” relevant to this discussion?
Accusing a “debate opponent” of fear and irrationality (falsely at that) does nothing to further the
discussion.
smokey:
You don't think seriously about biology.
Thank you for your opinion. I could just as easily spout “you don’t think seriously about
information theory.” But that wouldn’t get us anywhere now would it?
CJYman:
"Now, when I refer to "sequencing," I am merely referring to the order in which the units in a "chain" of complex specified information exist."
smokey:
"That's not what it means to people who talk about DNA on a daily basis, much less people who
work with it on a daily basis. If you're going to communicate with people, words have to have a
constant meaning, not whatever you want them to mean."
My apologies. Ok, well now that we are on the same page, and you know what I am talking about I’m sure you’ll have no problem following what I am saying. So, what word do people who talk about DNA on a daily basis use to refer to the order of units in a “chain” of information. If its not a “sequence” of units then what is it?
But hold on a sec. Maybe I shouldn’t be apologizing for my use of the word “sequencing.” Professor Hubert P. Yockey, who had published many times in “Journal of Theoretical Biology” states and I quote: ““The existence of the genome and the genetic code divides living organisms from non-living matter. There is nothing in the non-living physico-chemical world that remotely resembles the reactions that are determined by a SEQUENCE (i.e., the genome) and codes between SEQUENCES (i.e., the genetic code) that occur in living matter.” [caps lock added]
If you seriously can’t follow what I’m saying, and you don’t wish to ask what I mean, then you may leave my blog whenever you want. You aren’t bound by contract to stay.
CJYman:
"Let's start with this question: "is the base pair adenine-thymine physically attracted to the base pair guanine-cytosine, thus causing these base pairs to always preceed and follow each other on a strand
of DNA?"
smokey:
"No, let's start with the stupid, false statement itself: “In other words, there is complete freedom in the sequencing possibilities of the nucleotide bases.”
No, let’s start with MY question ... since Dr. Dembski’s assertion is off the topic of this thread (my
5 point summary). However, since the point you bring up is indeed interesting, let’s continue ...
smokey:
"Now, to falsify any claim of "complete freedom," all I need is a single case in which the freedom is
LESS than complete. IOW, I get to choose, not you. To translate your statement into English, given your ignorant redefinition of "sequencing," you are claiming that there are no constraints on which
DNA sequences can exist that are related to bases on the same strand of the DNA. That is so false that it is laughable, because there are many, many sequences that either:
1) exist in one organism but cannot be maintained in another;
2) cannot even be maintained in vitro (i.e., by PCR);
3) or form wild single-stranded (same backbone) secondary structures.
Do you disagree with any of these? If so, supply the data--quotes aren't data, and if you quote anyone, I'll take that as evidence that you lied deliberately.
Well, you’ve seemed “willing” to jump at almost anything (including false accusations of lying and
mistaken identity) to “provide evidence that I lied deliberately” which really doesn’t make any sense
in terms of debate etiquette ... but that’s just me ... giving the benefit of the doubt and not
jumping to (FALSE) accusations of DELIBERATE misrepresentation and lying. And if I QUOTE DATA am I deliberately lying?
Now, can you please provide me with a couple of the sequences which can not be maintained in vitro, as well as a link to one article per point which discusses the data relevant to the above three points. Thank you.
However, as to point 1) and 3) I don’t see the relevance to Dr. Dembski’s statement, but first can
you tell me what you mean by “maintained” in point 1).
For the sake of argument, I will agree with your above points. That definitely is interesting and I
would like to discover how this can be, or do scientists already know what causes this seeming irregularity with certain nucleotide sequences? So tell me, what CONSTRAINS or CAUSES any
of the sequencing possibilities? Is it physical attraction between neighbouring nucleotide bases? If
not, then even IF Dr. Dembski’s point doesn’t stand, mine still does.
Why do you not want to discuss my point that information is not defined by physical laws of
attraction? If it was, then for example the “A” would always be next to a “C” which would always
be next to a “T” ... etc, forming a periodic molecule without the ability to carry information.
Furthermore, on second thought, in order for DNA to carry information, there has to be “complete freedom in the sequencing possibilities” ... ie: “A”s, “C”s, “T”s, and “G”s can be in any order RELATIVE to its neighbouring nucleotides ... which, I’m quite sure, is what Dr. Dembski meant.
Having the ability for the units to be in any order RELATIVE to its neighbouring nucleotides is what “complete freedom of the sequencing possibilities” means.
I can see every possible combination of the four nucleotides in the sequence which codes for protein that I mentioned above.
However, since neither of us is Dr. Dembski, we can both only attempt to interpret EXACTLY what he meant.
CJYman:
"No knowledgeable person claims that natural selection creates information processors."
smokey:
"I claim that mutation (which is only accidental wrt fitness), NS, drift, and a host of other mechanisms create information processors."
CJYman:
"For the sake of the present discussion I agree. Now, how do you create an information processor
within a system, when there is no preceeding information processor within that system?"
smokey:
"In biology, all the evidence points to variation and selection.
Can you provide me with some data please. What provides variation and what does the selecting?
Furthermore, of what is the selection a function? Is it a function of survival, reproduction, etc?
CJYman:
"... that this must be accomplished in terms of programming by a previous information processor from outside of the system (but I've already discussed this)."
smokey:
"But you've made no sense, you've redefined important words to mean something different than they
really mean, and you've never looked at any relevant data. I hypothesize that you're afraid of data. This hypothesis predicts that you will resort to redefining terms, pointing to arguments instead of data, appeals to unqualified authorities, and quote-mining instead of citing data."
First, if you don’t understand what I am saying, please ask for clarification. This is how a
discussion proceeds. Many discussions around the world have flown in circles simply because of
lack of understanding of the opponent’s definitions.
Second, I’m open to correction ... please begin showing me where I have defined terms in my own words ("redefined") incorrectly and, if incorrect, I will change them. I’m not afraid to learn, are you?
If you would like to, please bring the data forward, as I have done in providing links to Dr.s Trevor
and Abel’s work, and to Dr. Voie’s paper and to Richard Dawkin’s discussion of information theory
and its relevance to DNA.
Here is another extremely relevant book that I am about to order, “Information theory and Molecular
Biology” by Hubert P. Yockey if you are interested in reading more on the topic of the relevance of information theory to biology. (This book is written by an “anti-IDer”)
Here
is a limited preview of the book.
The summary states: “Information Theory, Evolution and the Origin of Life presents a timely introduction to the use of information theory and coding theory in molecular biology. The genetical information system, because it is linear and digital, resembles the algorithmic language of computers. George Gamow pointed out that the application of Shannon's information theory breaks
genetics and molecular biology out of the descriptive mode into the quantitative mode and Dr. Yockey develops this theme, discussing how information theory and coding theory can be applied to molecular biology. He discusses how these tools for measuring the information in the sequences of the genome and the proteome are essential for our complete understanding of the nature and origin of life. The author writes for the computer competent reader who is interested in evolution and the origins of life.”
As to unqualified authorities ... Dr. Dembski is qualified to discuss the mathematics of information
theory, as are Dr.s Trevor and Abel, Voie, and Hubert qualified to discuss the problems and impossibility as a “mathematical truism” of the creation of information/processing systems by
stochastic processes; and Richard Dawkins is qualified to discuss the informational quality and quantity of the genome, and you and I are qualified to discuss anything that we basically understand. Do you disagree?
I would appreciate it if you would cease from making false accusations and general hand waving. If you would like to discuss something in particular, please bring your points forward or else I have no
more time for any “rant” with you.
CJYman:
"Where have I ever said that evolution was random?"
smokey:
"When you wrote, "Furthermore, why even bother postulating ACCIDENTAL OCCURENCES for the creation of information processors..."
CJYman:
"I actually state the exact opposite. Read "designed to evolve"."
smokey:
"I read "ACCIDENTAL OCCURENCES" and quoted it. You even capitalized it for emphasis. Now you're saying you didn't mean it, or did you lose track of the premise that I was
disputing?"
My apologies, I should have said “origination of the first information processor within our universe” as opposed to “creation of information processors.” It has now been changed for clarification.
Evolution occurs after the information/processing system is generated. Evolution (as a process
which mutates and generates information) can not occur before the first replicating information/processing system.
CJYman:
"Is hypocrisy a habit of yours ... stating (falsely at that) that others misrepresent your claim while you do the exact same to them?"
smokey:
"In what way have I misrepresented your claim, "Furthermore, why even bother postulating ACCIDENTAL OCCURENCES for the creation of information processors..."?
That was my bad for not being more specific. I have provided the necessary clarification now.
smokey:
"Or the ignorant claim, "DNA carries information in a very computer-like way, and we can measure the genome’s capacity in bits too, if we wish," given that, when challenged, you couldn't do
it?"
This is definitely a misrepresentation as you claimed that I made that particular statement, however I was merely quoting Dawkins and I stated that I was quoting him. So are you saying that Dr. Richard Dawkins is ignorant on information theory and genetics? He seemed to explain the correlation rather well, don’t you think?
smokey:
"Or the even more ignorant claim, “In other words, there is complete freedom in the sequencing
possibilities of the nucleotide bases”?
Again, as stated above, that was Dr. Dembski’s claim, which was one sentence in a couple paragraphs which I posted on a different blog, and it is a statement which is irrelevant to this thread.
Furthermore, you may be misunderstanding exactly what he is saying, as I have shown above.
However, my point which is relevant to this thread that it seems you had tried to refute but keep dancing around is: “information is not defined by physical laws of attraction.” If you agree with
that quote, then there is nothing more that you have brought up that points to any specific problems
within the subject of this thread (5 point summary).
"What evasion?"
You claim that it is simple, but you can't do it.
" ... different function = different information."
Absolutely. I'm challenging the pigheaded idea that you can quantitate the information and/or complexity by either sequence alone or function alone.
"First, just to let you know, I DO appreciate a civil discussion; one that does not impute motives,
emotions, and irrelevant accusations (ie: "you are bearing false witness") that aren’t backed with fact."
Then why don't you support your accusations (that you know more about biology than practicing biologists) with fact?
"I would appreciate it if you would continue to engage me here in only civil discussion. Thank you."
If you want to come off as civil to those of us who have devoted our careers to studying biology, you need to ratchet down your arrogant assumptions by an order of magnitude or two.
"Second, I presume that you are aware that in order to calculate information content, a knowledge of
the relevant information structure is necessary."
You don't have that knowledge, as your request below shows.
"So, I’ve asked for the relevant informational
structure (the sequence of nucleotides) which codes for those systems and you haven’t provided that yet."
All you need to explain is why 3 and 4 have FEWER nucleotides in their genomes than 1,2,5 and 1,2,3,5 respectively, but have a function that all the others don't--they each produce and secrete an antibody against the last rhinovirus that infected you.
The point I'm making is about relative information. 3,4,5, and 6 have all recombined (randomly, wrt function) their immunoglobulin genes, losing sequence in the process. How is it that they gained function from doing so, if it's so simple?
"I’m only asking for that information."
And I'm supplying it, and you won't address my point, because it demolishes all your pompous (and therefore rude), ignorant claims about information.
"Of course, if I did have the technical expertise I’m
guessing I could just go to some data bank on the net, enter in the relevant technical wording, and
find the relevant informational coding for those systems."
Not for your own cells! You'd merely have to understand how VDJ recombination occurs, but if you can't figure out how to quote multiple paragraphs, I doubt that you can follow this primer:
http://en.wikipedia.org/wiki/V(D)J_recombination
"Third, are you asking me these questions because, for some reason, you deny that information theory
applies to the information stored in DNA?"
Stop with the loaded question fallacies--they are incredibly dishonest. I am asking you these questions because they demonstrate how foolish your sweeping, pompous claims are.
"Actually, that is a direct quote from Richard Dawkins. Read the whole two para’s that I provided."
Actually, you didn't present it as a quote, because it is at the beginning of a paragraph WITHOUT quotation marks. You should learn how to quote properly.
"IF YOU FALSELY ACCUSE ME OF LYING ONE MORE TIME, I WILL NOT BE ABLE TO CONTINUE THIS DISCUSSION WITH YOU."
I haven't falsely accused you of anything. By beginning a new paragraph without quotation marks, you are clearly presenting the words as your own.
"Ummm ... yep, I checked it out and you’ve talked yourself into a bad case of mistaken identity. That quote did not originate from me."
You presented it as your own, since you did not put quotation marks at the beginning of the paragraph.
"You have just falsely accussed me of lying."
"If you would have actually read the full two para that I copied and went to the link I provided, you
would have noticed that I quoted Richard Dawkins because he gives an easy to understand explanation of information and its relation to the genome."
If you would have quoted him according to convention that is taught to primary school students, you would be accurate.
"Why do you seem so desperate to accuse me of lying?"
Why are you so desperate to claim that you know more about biology than biologists, when you clearly can't be bothered to learn basic biology?
"So desperate in fact, that you don’t read
where I said that I was about to quote Richard Dawkins."
I did read it. You did not open the paragraph with quotation marks, which means that it is your writing.
"Which claim? The one that “information is not defined by physical laws of attraction” – the one that you keep dancing around and haven’t addressed yet? Or are you referring to Dr. Dawkin’s
claim that we can measure the genome’s capacity in bits,..."
Is that meaningful? Is Dawkins a molecular biologist? Do literate people, describing something that belongs to someone named Dawkins, write "Dawkin's" or "Dawkins's"?
"... and my claim that I’m pretty sure that I could provide the number of bits of a given sequence of functional nucleotides if you would provide the sequence?"
I'm pointing out that your claim has nothing to do with functional information, as the example I offered goes the opposite way.
So, which is more relevant, function or number of nucleotides? Do the new antibodies that recognize the last rhinovirus that infected you reflect new information? Where did that information come from?
"Actually, since you aren’t giving me any genetic information,..."
I did give you sufficiently detailed genetic information, in the form of telling you how many alleles had recombined in each case. You are just too ignorant to recognize it.
"I’ll just find some myself and tell you
how many bits it contains."
Oh, boy! Ignorance on parade!
"-nucleotide sequence which codes for the structure of the protein:"
You're lying again. The coding for the structure of the protein only starts with ATG, and the title clearly states "segment." You're just wrong, because you are too lazy to learn before pontificating.
"-bits of information: 1722 bits"
Wrong. Clathrin heavy chain has much more information than that. It's a SEGMENT, goofball.
"And yes, since you do have the relevant experience, together with an information theoretician, you
WILL be able to begin to calculate the informational content of those systems which you named."
Not in terms of either nucleotides or function. I can't calculate it, but I do know the relative contents of those cells, and I get opposite answers if I start with nucleotides vs. function.
"Furthermore, you should add Dr.s Trevors, Abel, Voie, and Yockey to my list of “heroes” in this
discussion, along with Dr. Dembski."
Where are the data?
"But, naming each other’s “heroes” doesn’t seem to add to this
discussion."
No, because data are the basis for scientific discussion, and you can't discuss data coherently.
"Actually I did read through the paper,..."
The question is whether you read the paper, not whether you read through it. It's dishonest to cite a paper that you haven't really read.
"... and yes SOME of it was quite basic ... it was a basic
description of the genetic code and how information theory is applied, along with some more complicated equations."
Which you don't understand, and if you weren't so lazy, you would have made a real effort to understand the example I gave you, which illustrates why such papers are boring and only published in obscure journals.
"From my understanding it is restating those two paragraphs I quoted from Richard Dawkins (regarding information theory and the genome) with the relevant mathematics from information theory."
Then if you think that it's so wonderful, why does it indicate that the cells with an additional function have LESS information than cells that lack it?
"1) There is enough information (data) to show some of the basic math behind information theory and
its relation to the genetic code."
You don't know what you are talking about.
"I will admit that I don’t understand all of the math, but if any of it is incorrect, I’m sure you or an information theoretician will be gracious enough to point me in the right direction to a paper (obviously in a prestigious journal) which shows the irrelevance of information theory to the genetic code."
There you go with your dishonesty again. I'm not saying that information theory is irrelevant to the genetic code, because such a statement makes no sense, whether it is true or false. I'm saying that information, defined as encoding functions, does not simply correlate with the number of nucleotides present, and anyone who says so is a simpleton.
"3) An amazingly thought provocative point ... “the article was boring.”"
That explains why you didn't read it in any detail, correct?
"4) Sure, no problem, the application of information theory to biology shows us something new
about the world – that life is an informational system, and can be studied as such."
Your simplistic twaddle doesn't work, as my example shows.
"Furthermore, part
2 in the book, "Information theory and molecular biology" by Hubert Yockey discusses application of information theory to problems in molecular biology."
That's nice. Is anything in the book as simplistic as your claims? Do significant applications that generate data get published in books or in the primary scientific literature?
"As to “not supporting my claim” ... depends on which claim you are talking about. The only reason I posted this example is to show the relevance of information theory to the genome, which I initially presumed that a man of your expertise would already be aware of."
I am aware of it. I also am aware that you don't have a clue, so your preening is rude and pompous.
"Furthermore, if that paper wasn’t “good enough” for you, just search through the Journal of Theoretical Biology (as I have done), and you’ll find some relevant information,..."
Why would a theoretical journal have data, CJYman? Why wouldn't we read papers in the best journals, such as Nature or Cell (both of which I have published in)?
"... or we could discuss the basics of information theory and continue to learn together."
Don't take this the wrong way, but I think you'd be the only one learning, and your laziness with the example I offered suggests that your learning would occur slowly, if at all.
"Or I could provide you with some links to some relevant articles that were published in the Journal of Theoretical Biology if you so desire."
I'm interested in real biology (function), not theoretical biology. Why are you afraid of data?
"Richard Dawkins said that. I quoted him and was careful to give him the credit for the statements
that he made."
No, you were anything but careful.
"Now I would appreciate the same attention to detail from yourself."
I do pay attention to details. If a paragraph does not begin with a quotation mark, that detail says that it is not a quote.
"Are you denying this statement of Dawkins’? If so, I’m fine with discussing it."
It is ridiculously simplistic, as you would see if you actually engaged your brain with my example.
CJYman:
"However, I seriously think that if you were to give me all of the relevant genetic information of
these systems (compressed),..."
smokey:
"Great...except that's exactly what I already did for you, CJYman. I gave you all the relevant
genetic (and functional) information describing the differences between the genomes of their cells. Other than those differences, the rest of each genome's the same--all the cells come from you."
"I must have missed that somewhere then, ‘cause I didn’t seem to receive any of the genetic information from you. By genetic information, you do mean the sequence of nucleotides, correct?"
No, I mean all the descriptions of VDJ recombination. That's all the genetic information you need to rank the cells according to relative numbers of nucleotides.
"Can you please show me where I have behaved irrationally, where I have cited a paper that I didn’t read, and where I have claimed to do things that I can’t do?"
I have been doing so.
"Dr. Dembski knows something about information theory..."
Not according to other, better mathematicians. Can you name 5 mathematicians who endorse Dembski's math?
And since he has no expertise in biology, why are you evading the fact that his math is based on empirically false biological assumptions?
"... and if DNA is an information carrying molecule, then he will know the relevant application of information theory to DNA."
No, he doesn't; nor do you.
"Run away?!?!?! um ... riiiiight ... and where’s the genetic information you said you would supply?"
It's all there in my initial comment.
"Again, why are you imputing motive in this discussion and how is “fear” relevant to this discussion?"
Because it explains every one of your rhetorical moves in advance.
"Thank you for your opinion. I could just as easily spout “you don’t think seriously about
information theory.” But that wouldn’t get us anywhere now would it?"
But I do think seriously about information theory, as my example demonstrates. Your failure to engage shows that you don't think seriously about it.
"My apologies."
Accepted.
"Ok, well now that we are on the same page, and you know what I am talking about I’m sure you’ll have no problem following what I am saying. So, what word do people who talk about DNA on a daily basis use to refer to the order of units in a “chain” of information. If its not a “sequence” of units then what is it?"
It is a sequence (noun). But when sequence is used as a verb (sequencing), it refers to what WE do to DNA. You do understand the difference between nouns and verbs, don't you?
"But hold on a sec. Maybe I shouldn’t be apologizing for my use of the word “sequencing.” Professor Hubert P. Yockey, who had published many times in “Journal of Theoretical Biology” states and I quote: “...are determined by a SEQUENCE (i.e., the genome)..."
i.e., A NOUN,
"...and codes between SEQUENCES (i.e., the genetic code)..."
ANOTHER NOUN. Also, "sequences" doesn't translate to "the genetic code," which only refers to the translation of RNA to protein sequences.
"Well, you’ve seemed “willing” to jump at almost anything (including false accusations of lying and
mistaken identity) to “provide evidence that I lied deliberately” which really doesn’t make any sense
in terms of debate etiquette ..."
The first premise of debate etiquette is that you shouldn't pretend to have knowledge that you don't have--particularly when you are debating an expert.
"... but that’s just me ... giving the benefit of the doubt and not
jumping to (FALSE) accusations of DELIBERATE misrepresentation and lying. And if I QUOTE DATA am I deliberately lying?"
You don't "quote data." You would cite data instead of books if you were really interested in science instead of pseudoscience.
"Now, can you please provide me with a couple of the sequences which can not be maintained in vitro,..."
AAA AAA GCC GCC GCC GCC GCC GCC GCC GCC GCC AAA AAA AAA GGC GGC GGC GGC GGC GGC GGC GGC AAA AAA A
This forms a hairpin, and the bases within this single strand pair with each other.
"... as well as a link to one article per point which discusses the data relevant to the above three points. Thank you."
After you show me that you aren't being lazy wrt my initial example, which I presented in genetic detail, despite your denials. Learn about VDJ recombination and get back to me.
"However, as to point 1) and 3) I don’t see the relevance to Dr. Dembski’s statement, but first can
you tell me what you mean by “maintained” in point 1)."
An example is a mouse sequence that cannot be maintained in a bacterial plasmid.
"For the sake of argument, I will agree with your above points."
Then we agree that Dembski doesn't understand the basics of DNA physical chemistry! Progress!
"That definitely is interesting and I
would like to discover how this can be, or do scientists already know what causes this seeming irregularity with certain nucleotide sequences?"
Yes; unlike Dembskiite dilettantes, we do experiments.
"So tell me, what CONSTRAINS or CAUSES any
of the sequencing possibilities?"
Not "sequencing possibilities," just "sequences." The answer is simply physical laws of attraction.
"Is it physical attraction between neighbouring nucleotide bases?"
Sometimes, but in the case of the hairpin above, it is between nonadjacent bases.
(P.S. "Nucleotide bases" is just as goofy as the way you use "sequencing.")
"If
not, then even IF Dr. Dembski’s point doesn’t stand, mine still does."
I'm afraid that it doesn't.
"Why do you not want to discuss my point that information is not defined by physical laws of
attraction?"
I am discussing it, you goof!
"If it was, then for example the “A” would always be next to a “C” which would always
be next to a “T” ... etc, forming a periodic molecule without the ability to carry information."
It's much more complicated than that.
"Furthermore, on second thought, in order for DNA to carry information, there has to be “complete freedom in the sequencing possibilities” ... ie: “A”s, “C”s, “T”s, and “G”s can be in any order RELATIVE to its neighbouring nucleotides ... which, I’m quite sure, is what Dr. Dembski meant."
I'm quite sure he meant that, too, just as I'm quite sure that both of you are wrong. How do you account for the dearth of CpG dinucleotides in eukaryotic DNA, CJYman?
"Having the ability for the units to be in any order RELATIVE to its neighbouring nucleotides is what “complete freedom of the sequencing possibilities” means."
Yes, and it is wrong. Not all orders will work.
"I can see every possible combination of the four nucleotides in the sequence which codes for protein that I mentioned above."
That's nice, but is it true?
"However, since neither of us is Dr. Dembski, we can both only attempt to interpret EXACTLY what he meant."
I know that he is a fraud who is ignorant of basic molecular biology.
"Can you provide me with some data please."
I did in the first comment.
"What provides variation and what does the selecting?"
In the case I presented, recombination and the thymus, respectively.
"Furthermore, of what is the selection a function? Is it a function of survival, reproduction, etc?"
Reproduction is impossible without survival, but survival is not sufficient for reproduction.
"First, if you don’t understand what I am saying, please ask for clarification."
I did, in the form of asking you to apply your claims to an actual biological event that goes on in your own body, in real time.
"This is how a
discussion proceeds."
And you falsely claimed that I did not supply sufficient genetic information, when in fact, I did.
"Many discussions around the world have flown in circles simply because of
lack of understanding of the opponent’s definitions."
Which is why it is arrogant and rude to use different ones than those that are used by experts in a field.
"Second, I’m open to correction ... please begin showing me where I have defined terms in my own words ("redefined") incorrectly and, if incorrect, I will change them. I’m not afraid to learn, are you?"
Learning is my business. Why don't you see what you can learn from the example in my initial comment?
"If you would like to, please bring the data forward, as I have done in providing links to Dr.s Trevor
and Abel’s work,..."
Were there any data in the paper?
"Here is another extremely relevant book that I am about to order..."
Why not look at data?
"As to unqualified authorities ... Dr. Dembski is qualified to discuss the mathematics of information
theory,..."
Then name 5 information theoreticians who endorse his books. Name 5 papers that Dembski has published in mathematical journals on information theory.
"My apologies, I should have said “origination of the first information processor within our universe” as opposed to “creation of information processors.” It has now been changed for clarification."
It's not very clear.
"Evolution occurs after the information/processing system is generated. Evolution (as a process
which mutates and generates information) can not occur before the first replicating information/processing system."
Do honest people state their hypotheses as facts?
"This is definitely a misrepresentation as you claimed that I made that particular statement, however I was merely quoting Dawkins and I stated that I was quoting him."
But you didn't put quotation marks at the beginning of the paragraph, so any misrepresentation is yours alone.
"So are you saying that Dr. Richard Dawkins is ignorant on information theory and genetics?"
He ain't no molecular biologist.
"He seemed to explain the correlation rather well, don’t you think?"
No, as the lymphocyte example I offered demonstrates.
"Again, as stated above, that was Dr. Dembski’s claim, which was one sentence in a couple paragraphs which I posted on a different blog, and it is a statement which is irrelevant to this thread.
Furthermore, you may be misunderstanding exactly what he is saying, as I have shown above."
No, I understand it, and it is wrong.
"However, my point which is relevant to this thread that it seems you had tried to refute but keep dancing around is: “information is not defined by physical laws of attraction.” If you agree with
that quote,..."
I don't, which the lymphocyte example demonstrates. Unfortunately, you falsely accused me of not supplying genetic details, which I did.
Hello smokey,
I’m sorry I haven’t been on for a couple weeks now. Work took me on the road again, and when I’m on the road I’m extremely busy.
I am grateful to be able to carry on a discussion with a scientist who has published in prominent journals, and it is true that if any one is going to possibly be learning anything in this discussion between the two of us it is definitely going to be me.
However, as you are a scientist, I would presume that you would be slightly more attentive to details
than you have been in regards to one aspect of our discussion. That aspect which I am referring to is
the quote belonging to Dr. Dawkins, which you first said was a lie written by myself. Then, after I
told you that it was a quote from Dr. Dawkins, you said that I had not made that clear and that I had
not begun the quote with quotation marks. However, I will shortly post that very comment with a link to show that either you are lying or you just accidentally missed something. Both ways you FALSELY ACCUSED ME OF LYING (which I don’t take kindly to).
Quote myself:
“Actually, that is a direct quote from Richard Dawkins. Read the whole two para’s that I provided.”
Quote smokey:
“Actually, you didn't present it as a quote, because it is at the beginning of a paragraph WITHOUT quotation marks. You should learn how to quote properly.”
Quote myself:
“Richard Dawkins said that. I quoted him and was careful to give him the credit for the statements
that he made.”
Quote smokey:
“No, you were anything but careful.”
...AND...
Quote smokey:
“I do pay attention to details. If a paragraph does not begin with a quotation mark, that detail says
that it is not a quote.”
Actually, it was you who was lacking in care.
Quote myself:
“IF YOU FALSELY ACCUSE ME OF LYING ONE MORE TIME, I WILL NOT BE ABLE TO CONTINUE THIS DISCUSSION WITH YOU.”
Quote smokey:
“I haven't falsely accused you of anything. By beginning a new paragraph without quotation marks,
you are clearly presenting the words as your own.”
...AND...
Quote smokey:
“You presented it as your own, since you did not put quotation marks at the beginning of the paragraph.”
...AND...
Quote smokey:
“If you would have quoted him according to convention that is taught to primary school students, you would be accurate.”
...AND...
Quote smokey:
“I did read it. You did not open the paragraph with quotation marks, which means that it is your writing.”
And now for the EXACT ORIGINAL COMMENT from myself:
Quote myself (from comment #172
“Furthermore, in regards to measuring information, Richard Dawkins explains it well, from
http://www.ratbags.com/rsoles/comment/crexposed2.htm
“It was Shannon’s insight that information of any kind, no matter what it means, no matter whether
it is true or false, and no matter by what physical medium it is carried, can be measured in bits, and is translatable into any other medium of information. The great biologist J B S Haldane used
Shannon’s theory to compute the number of bits of information conveyed by a worker bee to her
hivemates when she “dances” the location of a food source (about 3 bits to tell about the direction of
the food and another 3 bits for the distance of the food). In the same units, I recently calculated that
I’d need to set aside 120 megabits of laptop computer memory to store the triumphal opening chords of Richard Strauss’s “Also Sprach Zarathustra” (the “2001? theme) which I wanted to play in the
middle of a lecture about evolution. Shannon’s economics enable you to calculate how much
modem time it’ll cost you to e-mail the complete text of a book to a publisher in another land. Fifty
years after Shannon, the idea of information as a commodity, as measurable and interconvertible as
money or energy, has come into its own.
DNA carries information in a very computer-like way, and we can measure the genome’s capacity in bits too, if we wish. DNA doesn’t use a binary code, but a quaternary one. Whereas the unit of information in the computer is a 1 or a 0, the unit in DNA can be T, A, C or G. If I tell you that a
particular location in a DNA sequence is a T, how much information is conveyed from me to you? Begin by measuring the prior uncertainty. How many possibilities are open before the message “T”
arrives? Four. How many possibilities remain after it has arrived? One. So you might think the information transferred is four bits, but actually it is two. Here’s why (assuming that the four letters are equally probable, like the four suits in a pack of cards). Remember that Shannon’s metric is
concerned with the most economical way of conveying the message. Think of it as the number of yes/no questions that you’d have to ask in order to narrow down to certainty, from an initial uncertainty of four possibilities, assuming that you planned your questions in the most economical way. “Is the mystery letter before D in the alphabet?” No. That narrows it down to T or G, and now we need only one more question to clinch it. So, by this method of measuring, each “letter” of the DNA has an information capacity of 2 bits.”
1. I clearly attributed the quote to Dr. Dawkins.
2. I opened/closed the appropriate section with quotation marks.
3. Why am I defending against such a minuscule (and false) attack on my use of proper punctuation?
3. If any of Dr. Dawkins quote is incorrect, please show me which part.
But, I’d rather not carry on this insignificant oversight by yourself any longer, since it is simply
“wasting paper” and detracting from the discussion.
So, back to the interesting stuff ...
smokey:
“You claim that it is simple, but you can't do it.”
Ummm ... just did it ...
I gave you the quantity of information, measured in bits, of the genetic information which codes for a segment of a protein.
CJYman:
" ... different function = different information."
smokey:
“Absolutely. I'm challenging the pigheaded idea that you can quantitate the information and/or
complexity by either sequence alone or function alone.”
Well, like it or not, information is quantified by knowledge of possible states in relation to actual states in a sequence of what is known as Shannon information. So, yes, using only the sequence and a knowledge of possible states/units, quantity of information can be calculated. For basics of information theory
BTW: I never said anything about quantifying the information by function alone.
Another thing I extremely dislike is other people putting words in my mouth.
When I wrote different function = different information, that is exactly what I meant. In a program, when two different functions are the resultant output, you know that they each have their respective different causal informational inputs.
“X” protein output = specific nucleotide sequence input (call it “x”)
“Y” protein output = specific nucleotide sequence input (will always be “not x”)
smokey:
“Then why don't you support your accusations (that you know more about biology than practicing
biologists) with fact?”
First, please do not put words in my mouth. Thank you. I never said nor implied that I know more about biology than practising biologists.
smokey:
“If you want to come off as civil to those of us who have devoted our careers to studying biology,
you need to ratchet down your arrogant assumptions by an order of magnitude or two.”
I am merely stating observations and ideas. If I think that I understand a specific aspect to be
correct, then I will argue for that aspect. I would love to continue this discussion with you. My apologies if I ever came across as arrogant. I merely state things how I see them and if you can show me that they are incorrect, please do so. I have changed my mind on many things in the past in relation to science and non-science. I love to learn. Among other things, this is what science is “all about” – debate and discovery of natural laws.
CJYman:
"Second, I presume that you are aware that in order to calculate information content, a knowledge
of the relevant information structure is necessary."
smokey:
“You don't have that knowledge, as your request below shows.”
Exactly, and that’s why I asked you for the relevant informational structure – so that I could calculate the information content.
CJYman:
“So, I’ve asked for the relevant informational structure (the sequence of nucleotides) which codes for those systems and you haven’t provided that yet.”
smokey:
"All you need to explain is why 3 and 4 have FEWER nucleotides in their genomes than 1,2,5 and 1,2,3,5 respectively, but have a function that all the others don't--they each produce and secrete an antibody against the last rhinovirus that infected you."
No where did I ever state that less informational content = less function. I said DIFFERENT function arises from DIFFERENT informational sequence.
smokey:
“ The point I'm making is about relative information. 3,4,5, and 6 have all recombined (randomly, wrt function) their immunoglobulin genes, losing sequence in the process. How is it that they gained
function from doing so, if it's so simple?”
The only thing that I said was [relatively] simple is the calculation of information content.
Your question is excellent and I would really like to know how life reorganizes its informational structure to “discover/stumble upon” new function. It may be that life itself is an amazingly intelligent (not conscious) information processing system – the living cell sure acts like it is intelligent, no?
CJYman:
"I’m only asking for that information."
smokey:
“And I'm supplying it, and you won't address my point, because it demolishes all your pompous (and therefore rude), ignorant claims about information.”
Which point of yours am I not addressing and how does it demolish ALL of my “pompous (and therefore rude), ignorant claims about information?”
Oh, and I would appreciate it if you would refrain from the unnecessary and false name calling unless you can indeed SHOW me where I am being pompous and rude. Thanks. I like contributors to keep in line with the “welcome” on the left column of my blog, and I always attempt to do the same and will apologize if I ever step out of line.
Again, as I’ve already said a few times, I have not received the genetic information, from yourself,
for those systems.
smokey:
“Not for your own cells! You'd merely have to understand how VDJ recombination occurs, but if you can't figure out how to quote multiple paragraphs, I doubt that you can follow this primer:”
Definitely looks like an intelligent process. I will discuss this further on in this comment.
CJYman:
“"Third, are you asking me these questions because, for some reason, you deny that information theory applies to the information stored in DNA?"
smokey:
“Stop with the loaded question fallacies--they are incredibly dishonest.”
Just asking ‘cause I seriously want to know where you are coming from. You seem to be somewhat confused when it comes to discussing “information.” Just an observation. Moreover, there is nothing “loaded” in that question. I just want your honest experienced and educated opinion.
smokey:
“I am asking you these questions because they demonstrate how foolish your sweeping, pompous
claims are.”
So, far, you’ve hardly addressed my claims! Furthermore, you SEEM to know very little about what you HAVE attempted to address – the calculation of information content.
CJYman:
"Why do you seem so desperate to accuse me of lying?"
smokey:
“Why are you so desperate to claim that you know more about biology than biologists, when you clearly can't be bothered to learn basic biology?”
Can you just answer the question? And, where have I claimed that I know more about biology than biologists? In fact, I haven’t even attempted to refute any biological claims that you have made. So far, I have only discussed the basics of information theory in calculating information content and the fact that a sequence of complex specified information isn’t defined by physical laws of attraction between its units (states).
You then provide me with the fact that some sequences of DNA form secondary structures and some won’t even form at all. This only shows that physical attraction causes secondary shapes. This does not show that physical laws of attraction define the original sequence itself. As to the other phenomenon – that of unmaintanable nucleotide sequences – I would like to ask you: “what causes that phenomenon?”
CJYman:
“Which claim? The one that “information is not defined by physical laws of attraction” – the one that you keep dancing around and haven’t addressed yet? Or are you referring to Dr. Dawkin’s claim that we can measure the genome’s capacity in bits,...”
smokey:
“Is that meaningful? Is Dawkins a molecular biologist? Do literate people, describing something that belongs to someone named Dawkins, write "Dawkin's" or "Dawkins's”?”
Ouch, you caught me ... I made a typo!?!?!? But don’t worry, I won’t be proof reading your replies in return as typos are not what I am discussing in this thread.
Seriously now, can we continue ...
smokey:
“I'm pointing out that your claim has nothing to do with functional information, as the example I offered goes the opposite way.”
You have pointed out no such thing. Your systems [presumably] arise from complex specified information, but are not complex specified information themselves. Furthermore, if there where a
finite number of possible and interchangeable states (units) within these systems, with a knowledge of the probability of each state’s possible occurence, they would be a representation of shannon information and the quantity of information could be calculated. But, this has nothing to do with the topic of this thread. I only showed you a very basic calculation of information content because ... I don’t even remember why any more ...
smokey:
“So, which is more relevant, function or number of nucleotides? Do the new antibodies that recognize the last rhinovirus that infected you reflect new information? Where did that information come from?”
Number of nucleotides is relevant to informational content.
When the recombination of DNA causes a specified function; that new sequence is complex and specified information. However, even is there is no function, it is still an example of shannon information, which can be quantified. All complex specified information is shannon information, but not all shannon information is complex specified information.
It seems that immunological ability is a process of generating complex specified information (IMO: learning) and applying the information in response to its environment thus showing one example of the cell itself being intelligent (but not necessarily conscious).
CJYman:
"Actually, since you aren’t giving me any genetic information,..."
Smokey:
“I did give you sufficiently detailed genetic information, in the form of telling you how many alleles had recombined in each case. You are just too ignorant to recognize it.”
Nope, actually, you didn’t give me the sufficiently detailed information to calculate informational quantity. By genetic information, you do mean the sequence of nucleotides, right? I haven’t received the sequence of nucleotides which cause those systems you referred to. Number of alleles is a start, now what would be needed is the number of nucleotides within each allele, and the probability of each nucleotide of occurring within the recombinant DNA.
BTW: do you remember what this has to do with any of the points in this thread?
CJYman:
"-nucleotide sequence which codes for the structure of the protein:"
smokey:
“You're lying again. The coding for the structure of the protein only starts with ATG, and the title clearly states "segment." You're just wrong, because you are too lazy to learn before pontificating.”
Incorrect. I never lied. I completely understood that it was a segment as that is what I wrote directly before: “"CLATHRIN HEAVY CHAIN PROXIMAL LEG SEGMENT (BOVINE)"(bold added)
I WAS tired, at the time, though. I did overlook RETYPING the word “segment” the second time.
However, I did identify the number of bits within that segment of the protein which I said I would do. Yet, I don’t see what this has to do with any of the points on the subject of this thread.
smokey:
“Wrong. Clathrin heavy chain has much more information than that. It's a SEGMENT, goofball.”
I gave you the bits of information of the SEGMENT, “goofball.” Am I right or wrong?
smokey:
“I can't calculate it, but I do know the relative contents of those cells, and I get opposite answers if I start with nucleotides vs. function.”
Well, I just calculated quantity of information of a segment of a protein.
With what quantity do you calculate the content, and what opposite answers do you get when you start with nucleotides vs. function? I will let you know ahead of time that shannon information has nothing to do with meaning or function.
smokey:
“No, because data are the basis for scientific discussion, and you can't discuss data coherently.”
Well, then, start providing the data which refutes any of the points in the topic of this thread. If you aren’t going to do this, then why are you here?
Or just jump over to the thread “the science of ID” and we can discuss that data there. Ie: the data (observations) that intelligence creates evolutionary algorithms, intelligence produces information, intelligence can program information processors to produce and use information, and that there is no data supporting any assertion that a random set of laws will create an information processor.
What, though, before we start, how do YOU define “data.” Furthermore, I’m sure you are aware that scientists deal with ideas which can be tested, correct?
smokey:
“The question is whether you read the paper, not whether you read through it. It's dishonest to cite a paper that you haven't really read.”
Thank you for that admonition. Seriously, I’m not being sarcastic. But when I said “read through” I meant “ read THROUGH” as in “I read the whole thing – beginning to end.” I did admit that I didn’t understand ALL of the mathematics, however the paper did back up my point – that of the applicability of information theory to genetic information. Can you show any of it to be incorrect?
smokey:
“Which you don't understand, and if you weren't so lazy, you would have made a real effort to understand the example I gave you, which illustrates why such papers are boring and only published in obscure journals.”
Ummmm ... I must be missing something here. What does that paper have anything to do with your
examples that you gave me? How does your example show the paper to be incorrect?
How do your examples show why that paper was “boring” and only published in an obscure
journal? But that isn’t even the point. Is the paper accurate or not?
smokey:
“Then if you think that it's so wonderful, why does it indicate that the cells with an additional
function have LESS information than cells that lack it?”
Because if you even just understood the very basics of information theory, you would realize that it has nothing to do with function. However, as I’ve already stated, when dealing with complex specified information, DIFFERENT function = DIFFERENT information. However, this says nothing of the quantity of function.
The possible answer to your question: either, there is overlapping complex specified information (an information compression strategy which is found elsewhere within DNA) or the extra functions just simply don’t require the same amount of information.
smokey:
“You don't know what you are talking about.”
Ummm actually, it is YOUR ignorance of the extreme basics of information theory which is shining through.
smokey:
“I'm saying that information, defined as encoding functions, does not simply correlate with the number of nucleotides present, and anyone who says so is a simpleton.”
True ... there is no pattern between function and number of nucleotides (this is what I’ve been saying all along) ... and ... what’s your point? ...
smokey:
“That explains why you didn't read it in any detail, correct?”
When I wrote “the article was boring” I was sarcastically quoting yourself.
CJYman:
"4) Sure, no problem, the application of information theory to biology shows us something new
about the world – that life is an informational system, and can be studied as such."
smokey:
“Your simplistic twaddle doesn't work, as my example shows.”
LOL!!!!! You’re going to have to explain to me how studying life as an informational system is simplistic twaddle. WOW ... at least you made me smile ... er ... laugh today.
And no, your examples show no such thing. Life is indeed an extremely complex information processing system and your example of the natural recombination of DNA in response to antigen threats is an excellent example.
smokey:
“That's nice. Is anything in the book as simplistic as your claims? Do significant applications that generate data get published in books or in the primary scientific literature?”
...AND...
smokey:
“Why would a theoretical journal have data, CJYman? Why wouldn't we read papers in the best journals, such as Nature or Cell (both of which I have published in)?”
Are you trying to imply that theoretical disciplines aren’t scientific? Is theoretical physics a scientific discipline? In fact, as far as I understand, in the Journal of Theoretical Biology, Hubert Yockey gives detailed examples of how to apply information theory to living systems. I’ll get back to you on that. If that is true, all someone needs to do is use his ideas to start generating data and then publish the results in the primary scientific literature. I’ll start checking into that as well for you.
CJYman:
“As to “not supporting my claim” ... depends on which claim you are talking about. The only reason I posted this example is to show the relevance of information theory to the genome, which I initially presumed that a man of your expertise would already be aware of.”
smokey:
“I am aware of it. I also am aware that you don't have a clue, so your preening is rude and pompous.”
You’re already aware of that? Then what are we arguing about? What don’t I have a clue about? And what do you mean by “preening?” Please quote me where I was being rude and pompous.
smokey:
“Don't take this the wrong way, but I think you'd be the only one learning, and your laziness with the example I offered suggests that your learning would occur slowly, if at all.”
No offense taken. However, once I understood what you were trying to say with your example I responded to it above. I am not a lazy learner ... but there’s no need for me to defend my intellectual energy ... let’s continue.
CJYman:
“Or I could provide you with some links to some relevant articles that were published in the Journal of Theoretical Biology if you so desire.”
smokey:
“I'm interested in real biology (function), not theoretical biology. Why are you afraid of data?”
Afraid of data? What makes you think I'm afraid of data? It has to be a theory first before it generates data, correct?
Are you afraid of scientific theories? Are you afraid of measuring the informational content of the genome, and are you afraid of the fact that a given sequence of nucleotides in a segment of DNA is not defined by physical laws of attraction?
CJYman:
“Can you please show me where I have behaved irrationally, where I have cited a paper that I didn’t read, and where I have claimed to do things that I can’t do?”
smokey:
“I have been doing so. “
You have only been creating general unsupported assertions. You have not SHOWN me where I have behaved irrationally, claimed to do things I can’t do, etc ...
smokey:
“Can you name 5 mathematicians who endorse Dembski's math?”
I probably could scour the internet and come up with five mathematicians who support Dembski’s math (probably among ISCID) but I don’t see how this would further our discussion, since I haven’t even dealt with Dembski’s mathematical approach.
Furthermore:
“Copernicus' heliocentric system was considered implausible by the vast majority of his contemporaries, and by most astronomers and natural philosophers until the middle of the seventeenth century. Its notable defenders included Johannes Kepler (1571 -1630) and Galileo Galilei (1564 - 1642). Strong theoretical underpinning for the Copernican theory was finally provided by Sir Isaac Newton's theory of universal gravitation (1687).”
http://www.lucidcafe.com/library/96feb/copernicus.html
I’m sure I don’t have to explain my inclusion of the above quote.
CJYman:
“I can see every possible combination of the four nucleotides in the sequence which codes for
protein that I mentioned above.”
smokey:
“That's nice, but is it true?”
Actually, each nucleotide does appear either before or after every other nucleotide showing that the sequence (being aperiodic) is not defined by physical laws of attraction between the nucleotides.
CJYman:
“What provides variation and what does the selecting?”
smokey:
“In the case I presented, recombination and the thymus, respectively.”
Actually, if you read my statement immediately before, you would have seen that I was asking what provides variation and what does the selecting in the absence of an information processor? I was asking what allows evolution of information before an information processing system exists.
smokey:
“Which is why it is arrogant and rude to use different ones than those that are used by experts in a
field.”
Can you prove that scientifically? Sorry ... couldn't resist ;)
Point taken. This discussion is an excellent opportunity for myself to learn technical termination.
However, I disagree that using the language that I DO possess is arrogant and rude. If that were true then there would be no way to learn and discuss ideas that I do understand (albeit not technically) with someone who has the technical understanding. I honestly think that you are the one who is being rude here by calling me arrogant, when all I am doing is providing ideas that I believe to be true that you have not yet disproved. As the biologist, you should be the one who is more understanding if I use the “wrong” wording.
Furthermore, it seems that the only quibble was between the word “sequence” and “sequencing” and I now completely understand your point.
And I’m sure I’m not really hurting your feelings ... you are a scientists after all. I’m sure you’re somewhat used to “hot dialogue” of scientific ideas.
CJYman:
“My apologies, I should have said “origination of the first information processor within our universe” as opposed to “creation of information processors.” It has now been changed for clarification.”
smokey:
“It's not very clear.”
Can you help me out here, then. Which part is unclear? Can you tell me what it appears that I am stating and asking?
CJYman:
“Evolution occurs after the information/processing system is generated. Evolution (as a process which mutates and generates information) can not occur before the first replicating information/processing system.”
smokey:
“Do honest people state their hypotheses as facts?”
You have more contact with scientists; maybe you can tell me. It is an observed and logical fact that information can not be mutated and generated apart from an information processing system.
Information is useless (and non-existant) without an information processing system. Furthermore, in life, the information processing system must replicate in order for evolution to continue. This is a factual theory. Are there any competing theories?
CJYman:
“However, my point which is relevant to this thread that it seems you had tried to refute but keep dancing around is: “information is not defined by physical laws of attraction.” If you agree with
that quote,...”
smokey:
“I don't, which the lymphocyte example demonstrates. Unfortunately, you falsely accused me of not supplying genetic details, which I did.”
No, I didn’t accuse you of not providing genetic “details.” I accused you of not providing genetic “information” – that IS how you guys refer to a sequence of nuleotides in a segment of DNA, correct?
Can you run that lymphocyte example by me again, while you lay out your argument that information IS defined by physical laws of attraction? I must be missing something.
To cap everything up so far ... aside from a seeming attempt at denying that genetic information is not defined by physical laws of attraction between its nucleotides, you haven’t even effectively addressed any points of this thread ... yet.
"Then, after I told you that it was a quote from Dr. Dawkins, you said that I had not made that clear and that I had not begun the quote with quotation marks."
No, try rereading what I actually wrote slowly, digesting each word, and then confirm it by reading examples written by literate people in newspapers, novels, and magazines:
“Actually, you didn't present it as a quote, because it is at the beginning of a paragraph WITHOUT quotation marks. You should learn how to quote properly.”
“I haven't falsely accused you of anything. By beginning a new paragraph without quotation marks, you are clearly presenting the words as your own.”
“I did read it. You did not open the paragraph with quotation marks, which means that it is your writing.”
Then you show that you are unable to understand something that I wrote three separate times:
"2. I opened/closed the appropriate section with quotation marks."
Literate people don't merely open and close a quoted section with quotation marks. Literate people put a quotation mark at the beginning of EACH NEW PARAGRAPH.
The convention in English is to give the first and each subsequent paragraph opening quotes, using closing quotes only for the final paragraph of the quotation.
The fact that you did this demonstrates incompetence. The fact that you can't understand what you did wrong is mind-boggling.
"I gave you the quantity of information, measured in bits, of the genetic information which codes for a segment of a protein."
Does that protein segment have any function?
"First, please do not put words in my mouth. Thank you. I never said nor implied that I know more about biology than practising biologists."
You don't claim to know more about the origin(s) of biological information than practicing biologists?
"My apologies if I ever came across as arrogant."
You still are.
"I merely state things how I see them..."
But the problem is that you can't be bothered to look before pretending that you've seen things. That's arrogance.
"Exactly, and that’s why I asked you for the relevant informational structure – so that I could calculate the information content."
I gave a precise description of the differences in terms of which alleles had rearranged.
"No where did I ever state that less informational content = less function. I said DIFFERENT function arises from DIFFERENT informational sequence."
But this is ADDITIONAL function from losing information (according to you), not merely different.
"Your question is excellent and I would really like to know how life reorganizes its informational structure to “discover/stumble upon” new function."
Variation and selection in most cases.
"It may be that life itself is an amazingly intelligent (not conscious) information processing system – the living cell sure acts like it is intelligent, no?"
No.
"Definitely looks like an intelligent process. I will discuss this further on in this comment."
How is variation and selection an intelligent process? Are you claiming that Darwinan evolution is an intrinsically intelligent process without a designer, then?
"...And, where have I claimed that I know more about biology than biologists?"
In everything you write about biology!
"You then provide me with the fact that some sequences of DNA form secondary structures and some won’t even form at all. This only shows that physical attraction causes secondary shapes."
Hairpins don't get replicated very well, if at all.
Then you, both arrogantly and ignorantly, looked at only dinucleotides from a sequence fragment and declared a global negative.
Do the hairpins involve more than dinucleotides?
"...As to the other phenomenon – that of unmaintanable nucleotide sequences – I would like to ask you: “what causes that phenomenon?”
I'm giving you a prominent example, but apparently, you are too dense to understand it.
"You have pointed out no such thing. Your systems [presumably] arise from complex specified information, but are not complex specified information themselves."
Total hooey. Arrogant, too.
I asked: “So, which is more relevant, function or number of nucleotides? Do the new antibodies that recognize the last rhinovirus that infected you reflect new information? Where did that information come from?”
"Number of nucleotides is relevant to informational content."
Try and read. The question was, which is MORE relevant?
"When the recombination of DNA causes a specified function; that new sequence is complex and specified information."
Good! Then we've demonstrated that CSI arises from nothing more than variation (blind) and selection, meaning that Dembski is totally wrong when he claims that it indicates intelligent design.
"However, even is there is no function, it is still an example of shannon information, which can be quantified."
Then we agree that there's no correlation between information and function, and Dembski is a charlatan.
"It seems that immunological ability is a process of generating complex specified information (IMO: learning) and applying the information in response to its environment thus showing one example of the cell itself being intelligent (but not necessarily conscious)."
It's clear that it is generated by nothing more than genetic variation (blindly) and selection. No one designed your Ig genes to recognize rhinoviruses.
"Nope, actually, you didn’t give me the sufficiently detailed information to calculate informational quantity. By genetic information, you do mean the sequence of nucleotides, right?"
Yes! What happens to any sequence that has undergone intramolecular recombination? Has it lost or gained information?
"I haven’t received the sequence of nucleotides which cause those systems you referred to. Number of alleles is a start, now what would be needed is the number of nucleotides within each allele, and the probability of each nucleotide of occurring within the recombinant DNA."
Then look it up!
"Incorrect. I never lied. I completely understood that it was a segment as that is what I wrote directly before: “"CLATHRIN HEAVY CHAIN PROXIMAL LEG SEGMENT (BOVINE)"(bold added)"
But you lied about the parts of the sequence that encoded protein.
"However, I did identify the number of bits within that segment of the protein which I said I would do. Yet, I don’t see what this has to do with any of the points on the subject of this thread."
Does the segment have any function?
smokey:
“Wrong. Clathrin heavy chain has much more information than that. It's a SEGMENT, goofball.”
I gave you the bits of information of the SEGMENT, “goofball.” Am I right or wrong?
"Well, I just calculated quantity of information of a segment of a protein."
Does that segment have any function?
"What, though, before we start, how do YOU define “data.”"
Observations.
"Furthermore, I’m sure you are aware that scientists deal with ideas which can be tested, correct?"
Yes. Real scientists test the ideas, too!
"Because if you even just understood the very basics of information theory, you would realize that it has nothing to do with function. However, as I’ve already stated, when dealing with complex specified information, DIFFERENT function = DIFFERENT information. However, this says nothing of the quantity of function."
So quantitating information is meaningless wrt function.
"LOL!!!!! You’re going to have to explain to me how studying life as an informational system is simplistic twaddle."
Because you can't apply information theory to VDJ recombination.
"And no, your examples show no such thing. Life is indeed an extremely complex information processing system and your example of the natural recombination of DNA in response to antigen threats is an excellent example."
Sorry, but the recombination of DNA does not occur in response to antigens at all. That's yet another example of your astounding arrogance. If you don't know something, you simply fabricate it.
"Are you trying to imply that theoretical disciplines aren’t scientific?"
At best, they are incomplete.
"In fact, as far as I understand, in the Journal of Theoretical Biology, Hubert Yockey gives detailed examples of how to apply information theory to living systems."
And what new data has Hubert Yockey produced as a result of this alleged application?
"I’ll get back to you on that. If that is true, all someone needs to do is use his ideas to start generating data and then publish the results in the primary scientific literature. I’ll start checking into that as well for you."
I predict that you won't.
"Afraid of data? What makes you think I'm afraid of data? It has to be a theory first before it generates data, correct?"
What a profoundly ignorant thing to say! Hypotheses are only promoted to theory status AFTER they have produced mountains of data. IOW, the term "ID theory" is a lie.
"I probably could scour the internet and come up with five mathematicians who support Dembski’s math (probably among ISCID) but I don’t see how this would further our discussion, since I haven’t even dealt with Dembski’s mathematical approach."
Actually, you did, since you concluded that VDJ recombination generates CSI, despite the fact that it consists of nothing but the generation (random wrt fitness) of genetic variance and selection.
"Actually, each nucleotide does appear either before or after every other nucleotide showing that the sequence (being aperiodic) is not defined by physical laws of attraction between the nucleotides."
That is truly breathtaking arrogance. How can you claim to have addressed all the combinations when you limit yourself to considering dinucleotides only?
"Actually, if you read my statement immediately before, you would have seen that I was asking what provides variation and what does the selecting in the absence of an information processor? I was asking what allows evolution of information before an information processing system exists."
Variation and selection IS an information processing system. It generates what YOU describe as CSI with no intelligent intervention.
"You have more contact with scientists; maybe you can tell me."
Stating a hypothesis as fact is extremely unethical.
"It is an observed and logical fact that information can not be mutated and generated apart from an information processing system."
The example I offered shows that you regard mere genetic variation and selection as an information processing system.
"Information is useless (and non-existant) without an information processing system. Furthermore, in life, the information processing system must replicate in order for evolution to continue. This is a factual theory."
"Factual theory" is an oxymoron.
"No, I didn’t accuse you of not providing genetic “details.” I accused you of not providing genetic “information” – that IS how you guys refer to a sequence of nuleotides in a segment of DNA, correct?"
No, we call it a sequence, and sequencing is what we do to get it.
"Can you run that lymphocyte example by me again, while you lay out your argument that information IS defined by physical laws of attraction? I must be missing something."
Can't all the molecular mechanisms of VDJ recombination be explained in terms of physical laws of attraction?
Regarding the off topic argument re: the use of quotations at the beginning of every para when quoting multiple paras:
Oh, dear, you caught me at a typo. I was cutting and pasting and forgot to put quotes at the beginning of every para. My apologies. However, I personally think that you'd have to be pretty dense not to notice that I first SAID THAT I WAS QUOTING DAWKINS and then immediately STARTED THE QUOTATION WITH QUOTATION MARKS and ENDED THE QUOTATION a couple paras later WITH QUOTATION MARKS. But yes, I will be more careful in the future.
I might see how you may be slightly confused as to where the quotation ends, but there is no possible way to mistake where the quotation begins, and thus to accuse me of lying instead of merely clarifying with me where the quotation ends is a reflection of either paranoia, or simply horrible debate etiquette on your part for the sole purpose of scoring cheap rhetorical points which are completely irrelevant to the discussion at hand.
Conclusion: I made a typo and you appear to be somewhat dense because you can’t understand context (that it was indeed a quote -- which is exactly what I SAID it was). Then, in a seemingly desperate attempt to discredit me, you accuse me of lying. According to yourself, I said that I could do something that I couldn’t do, however I definitely and clearly said that I was quoting Dawkins and then STARTED THE FIRST PARA OF THE WHOLE QUOTE WITH QUOTATION MARKS AND THEN DID NOT CLOSE THE QUOTATION MARKS UNTIL THREE PARAS LATER. A semi-intelligent person who was not paranoid would have noticed the reference to Dawkins, would have noticed the first set of quotation marks, and then would have looked for the end quotation marks and if confused would have simply asked for clarification. Furthermore a semi-intelligent person who was not paranoid would not have been scouring my comments looking for the slightest way in which to contort how I presented those statements and call me a liar.
For someone as observant as yourself, it is my personal opinion that you’d have to be pretty dense or overwhelmingly desperate to accuse me of lying and not see that I was quoting Dawkins – which is exactly what I said I was doing.
CJYman:
"I gave you the quantity of information, measured in bits, of the genetic information which codes for a segment of a protein."
smokey:
"Does that protein segment have any function?"
What does this have to do with what we are discussing?
CJYman:
"First, please do not put words in my mouth. Thank you. I never said nor implied that I know more about biology than practising biologists."
smokey:
"You don't claim to know more about the origin(s) of biological information than practicing biologists?"
First, by "practicing biologists" are you referring to yourself?
Second, do you or any practicing biologists actually know anything about the origin of information itself which, after the information underlying our universe, is presumably biological.
Third, before I answer your question, do you know what information is? Can you provide a concise scientific definition of information?
However, I will say right now that you have shown a lack of understanding of measurement of shannon information by continually asking questions of how function relates to the measurement of shannon information. Here's a hint - it doesn't.
CJYman:
"My apologies if I ever came across as arrogant."
smokey:
"You still are."
Well, thank you for your opinion. Does it really matter?
CJYman:
"I merely state things how I see them..."
smokey:
"But the problem is that you can't be bothered to look before pretending that you've seen things. That's arrogance."
Can you prove that I haven't bothered to look? If not, are you lying about how much I’ve “looked” or are you merely ignorant about how much I’ve “looked?” Furthermore, have you even knocked down any of my points or conclusions yet? Nope.
CJYman:
"Exactly, and that’s why I asked you for the relevant informational structure – so that I could calculate the information content."
smokey:
"I gave a precise description of the differences in terms of which alleles had rearranged."
Sure, and why won't you just cough up the necessary genetic information involved?
CJYman:
"No where did I ever state that less informational content = less function. I said DIFFERENT function arises from DIFFERENT informational sequence."
smokey:
"But this is ADDITIONAL function from losing information (according to you), not merely different."
For the sake of argument, I agree. Now, what does this show in regard to what we are discussing?
As far as I can tell, it only means that some functions require more information than other functions.
CJYman:
"It may be that life itself is an amazingly intelligent (not conscious) information processing system – the living cell sure acts like it is intelligent, no?"
smokey:
"No."
I disagree, since intelligence (not consciousnes) is basically characterized by its ability to generate new functional information (learn) and use this information in response to its environment. If you do not agree with me, then cite one example of a basic characteristic of intelligence which does not manipulate, generate, or use information. A good place to start looking would be at artificial intelligence or into neuroscience and how neurons (necessary for human intelligence) are similar to logic gates.
Furthermore, life itself seems to also make use of logic gates. If you know anything about logic gates, you will understand that they are the foundation of information processing systems. And, from present scientific understanding, information processing is the foundation of intelligence.
Now for some articles discussing how life makes use of logic gates and information processing.
-here
-here
-here
Just so you know, a logic gate does not need to be electronic. The medium has nothing to do with whether a switch is a logic gate of not. In fact, I have designed a couple mechanical logic gates from simple gears, elastic bands, and rods. I haven’t built them yet, however, there are demonstrations of mechanical logic gates on the web that have been built. If you arrange these logic gates correctly, then you can make a mechanical adder which adds binary digits. The point is that a switch or logic gate can be made of any material, even chemical/biochemical.
CJYman:
"Definitely looks like an intelligent process. I will discuss this further on in this comment."
smokey:
"How is variation and selection an intelligent process? Are you claiming that Darwinan evolution is an intrinsically intelligent process without a designer, then?
IMO, variation and selection is intrinsically a learning process. Intelligent systems learn.
It is my personal opinion that the living cell itself is the intelligent (not conscious) designer and that evolution is merely a result of cellular intelligence. In fact, I have begun to wonder if learning and evolution are similar.
Furthermore, I do think that the living cell was DESIGNED to NECESSARILY evolve.
CJYman:
"You then provide me with the fact that some sequences of DNA form secondary structures and some won’t even form at all. This only shows that physical attraction causes secondary shapes."
smokey:
"Hairpins don't get replicated very well, if at all."
OK ...
smokey:
"Then you, both arrogantly and ignorantly, looked at only dinucleotides from a sequence fragment and declared a global negative."
I've only stated that complex specified information is not defined by physical laws of attraction and you haven't provided an example where a sequence of complex specified information (functional shannon information) is defined by physical laws of attraction between its units.
smokey:
"Do the hairpins involve more than dinucleotides?"
Could you please explain the relevance that this would have within the subject of this thread?
CJYman:
"You have pointed out no such thing. Your systems [presumably] arise from complex specified information, but are not complex specified information themselves."
smokey:
"Total hooey. Arrogant, too."
Excellent rebuttal -- I wish my reasoning skills were as honed as yours.
BTW: do you even have a basic understanding of complex specified information?
Furthermore, who cares if someone SUBJECTIVELY SEEMS ARROGANT TO YOURSELF.
The focal point should be ... Are the points being brought up valid and/or true?
In light of how many times you have called me a liar and have said that I was arrogant in this discussion, I think a little reminder must be stated. “Debate against the points/conclusion, not against the persons supposed character.” I’m sure I don’t need to explain the definition of ad hominem arguments and its fallacy to you, or do I?
smokey:
"I asked: “So, which is more relevant, function or number of nucleotides? Do the new antibodies that recognize the last rhinovirus that infected you reflect new information? Where did that information come from?”"
CJYman:
"Number of nucleotides is relevant to informational content."
smokey:
"Try and read. The question was, which is MORE relevant?"
And I answered the question. You obviously STILL do not understand that function has NO RELEVANCE to the QUANTITY of SHANNON INFORMATION content, although I've told you this already. YOU seem to be the one with reading comprehension issues.
CJYman:
"When the recombination of DNA causes a specified function; that new sequence is complex and specified information."
smokey:
"Good! Then we've demonstrated that CSI arises from nothing more than variation (blind) and selection, meaning that Dembski is totally wrong when he claims that it indicates intelligent design.
That seems to be only a partial truth. Doesn't the CSI that arises from the workings of the immune system arise as a result of an information processing system which searches through a “shape” space and which is a necessary result of the information which codes for these particular operations (roles) within the immune system. IOW, what you are saying seems to be tantamount to stating that just because an evolutionary program on a computer randomly searches for a solution, therefore the program and information processor itself doesn’t require intelligence in its designing and does not need to be designed with the functions that allow it to perform random searches.
Furthermore, variation and selection can only happen within a type of information processing system, and one hypothesis is that a random set of laws will not cause an information processing system to randomly self-organize, and that intelligent programming of laws (and direct intervention) is the only cause of information processing systems.
Therefore, if an information processing system is necessary for variation and selection and that information processing system is necessarily a result of intelligent programming, then variation and selection (which only RE-ARRANGE EXISTING information into new information) are necessarily a result of intelligence. Thus, if that is true, (along with the fact that CSI cannot exist independently of an information processing system) then CSI is an indication of prior intelligence.
CJYman:
"However, even is there is no function, it is still an example of shannon information, which can be quantified."
smokey:
“Then we agree that there's no correlation between information and function, and Dembski is a charlatan.”
First off, I have no desire or need to call anyone names, as that doesn’t provide adequate response to any relevant issues.
Second, I’ve honestly not read near enough of Dembski’s works to debate either for or against the issues he presents. So, unfortunately, I can’t provide my opinion at this time re: Dembski and his complete views on information and function.
However, I do know one thing, and this seems to be where you are getting hung up:
Complex specified information is shannon information which DOES HAVE function. Yet, the function itself has no affect on the quantity of information.
Furthermore, the calculation of shannon information itself is independent of function or meaning.
FOR EXAMPLE:
(assuming same probability of all letters)
-“can you read this” is an example of both shannon and complex specified information and, including spaces, contains 85 bits of shannon information.
-“hfdnc dsjaoif gdu” is an example of shannon information but NOT complex specified information and it also contains 85 bits of shannon information.
Thus complex specified information (functional info.) is shannon information however not all shannon information is necessarily complex specified information (functional info.).
BTW: as far as I am aware, Dembski did NOT coin the term or idea of complex specified information.
CJYman:
"It seems that immunological ability is a process of generating complex specified information (IMO: learning) and applying the information in response to its environment thus showing one example of the cell itself being intelligent (but not necessarily conscious)."
smokey:
“It's clear that it is generated by nothing more than genetic variation (blindly) and selection. No one designed your Ig genes to recognize rhinoviruses.”
Sure, but what allows and causes variation and selection of pre-existing information? Isn’t the cell itself doing the designing? Is the recognition process not generated by an information processing system? Ah, but then, you’re probably not the person to whom I should be directing this question, since you SEEM to be somewhat ignorant of the subject of information processing.
CJYman:
"Nope, actually, you didn’t give me the sufficiently detailed information to calculate informational quantity. By genetic information, you do mean the sequence of nucleotides, right?"
smokey:
“Yes! What happens to any sequence that has undergone intramolecular recombination? Has it lost or gained information?”
Depends on the length of the recombined sequence.
CJYman:
"I haven’t received the sequence of nucleotides which cause those systems you referred to. Number of alleles is a start, now what would be needed is the number of nucleotides within each allele, and the probability of each nucleotide of occurring within the recombinant DNA."
smokey:
“Then look it up!”
I have neither the need nor the time to do so. I’m only saying that you said you’d provide the necessary genetic information to calculate information content but you haven’t done so yet. Were you lying, or was there just a simple misunderstanding?
CJYman:
"Incorrect. I never lied. I completely understood that it was a segment as that is what I wrote directly before: “"CLATHRIN HEAVY CHAIN PROXIMAL LEG SEGMENT (BOVINE)"(bold added)"
smokey:
“But you lied about the parts of the sequence that encoded protein.”
Actually, I was careful not to include those parts of the sequence that do not encode for the protein... as far as I could tell from the protein data bank that I was using. Could it be that, in accusing me of lying, YOU are lying? Even IF I missed something, it was an honest mistake ... nothing near a lie. But alas, this seems to be a concept that you just can not comprehend.
Why are you so desparate to accuse me of lying such that every time that I show you that I wasn’t lying you always shift the focus and accuse me of lying about something else.
The only thing I have possibly lied about is that I said that if you accused me of lying one more time, I would not be able to continue this discussion with you.
But, since I am continuing this discussion with you, I see this more as extending forgiveness and the benefit of the doubt than lying, since you are obviously mistaken about my moral/ethical habits.
CJYman:
"However, I did identify the number of bits within that segment of the protein which I said I would do. Yet, I don’t see what this has to do with any of the points on the subject of this thread."
smokey:
Does the segment have any function?
Why don’t you tell me.
CJYman:
"Because if you even just understood the very basics of information theory, you would realize that it has nothing to do with function. However, as I’ve already stated, when dealing with complex specified information, DIFFERENT function = DIFFERENT information. However, this says nothing of the quantity of function."
smokey:
“So quantitating information is meaningless wrt function.”
At least in regard to measuring shannon information. I’ve explained the difference and similarity between shannon information and complex specified information above.
CJYman:
"And no, your examples show no such thing. Life is indeed an extremely complex information processing system and your example of the natural recombination of DNA in response to antigen threats is an excellent example."
smokey:
“Sorry, but the recombination of DNA does not occur in response to antigens at all. That's yet another example of your astounding arrogance. If you don't know something, you simply fabricate it.”
My apologies for not being as clear in pointing out what I meant. I should have said "as an effective response to" instead of "in response to."
Isn’t the recombination of DNA a vital step to providing adequate functional response to antigens?
If I am wrong about this, it’s because I misunderstood the wikipedia article that you directed me to: “V(D)J recombination is a mechanism of DNA recombination that occurs in vertebrates, which randomly selects and assembles segments of genes encoding specific proteins with important roles in the immune system.[1] This site-specific recombination reaction generates a diverse repertoire of T-cell receptor (TCR) and immunoglobulin (Ig) molecules that are necessary for the recognition of diverse antigens.”
Nevertheless, my point still stands. Life is an extremely complex information processing system and your example of natural recombination of DNA, whether an effective response to antigens or not, is an excellent example as long as it provides function. Functional information is being processed (converted and used) correct?
CJYman:
"Are you trying to imply that theoretical disciplines aren’t scientific?"
smokey:
“At best, they are incomplete.”
Agreed. This is a position that every scientific hypothesis/theoretical discipline is in at one point or another. In fact, I wonder if any scientific theory is ever really complete.
CJYman:
“In fact, as far as I understand, in the Journal of Theoretical Biology, Hubert Yockey gives detailed examples of how to apply information theory to living systems."
smokey:
“And what new data has Hubert Yockey produced as a result of this alleged application?
I am not aware of anything that he himself has produced. But, like I said, as far as I understand, the detailed examples are outline within the Journal and are available for other scientists to draw on.
CJYman:
"I’ll get back to you on that. If that is true, all someone needs to do is use his ideas to start generating data and then publish the results in the primary scientific literature. I’ll start checking into that as well for you."
smokey:
“I predict that you won't.”
And which hypothesis of yours is falsified when I do?
Here is a start. Here
is a lab which is applying information theory to evolving systems. The Home Page also has a link to publications, if you are interested.
CJYman:
"Afraid of data? What makes you think I'm afraid of data? It has to be a theory first before it generates data, correct?"
smokey:
“What a profoundly ignorant thing to say! Hypotheses are only promoted to theory status AFTER they have produced mountains of data. IOW, the term "ID theory" is a lie.”
That depends on how literally you choose to use the word “theory.” Is string “theory” really a theory? Some scientists seem to say “yes” while others seem to say “no.” Has string theory really generated any data (observation)?
Claude Shannon’s paper was titled “a mathematical theory of communication” when it was first published. I’m wondering how many observations it produced before the paper was first published.
And no, the term “ID theory” is not a lie at all. I discuss this in the thread “The science of Intelligent Design.”
CJYman:
"I probably could scour the internet and come up with five mathematicians who support Dembski’s math (probably among ISCID) but I don’t see how this would further our discussion, since I haven’t even dealt with Dembski’s mathematical approach."
smokey:
“Actually, you did, since you concluded that VDJ recombination generates CSI, despite the fact that it consists of nothing but the generation (random wrt fitness) of genetic variance and selection.”
No, I used a phrase that Dembski also uses but did not create, yet I did not deal with his mathematical approach. And yes, if VDJ recombination generates information that can be converted into functional molecules, then it is generating CSI, as far as I understand the term.
CJYman:
"Actually, each nucleotide does appear either before or after every other nucleotide showing that the sequence (being aperiodic) is not defined by physical laws of attraction between the nucleotides."
smokey:
“That is truly breathtaking arrogance. How can you claim to have addressed all the combinations when you limit yourself to considering dinucleotides only?”
You obviously don’t understand what I am saying. In addressing every possible combination of neighboring nucleotides and the fact that their sequence is not dictated by physical laws of attraction and that the WHOLE sequence is aperiodic (in line with Paul Davies predicted “aperiodic crystals”), it is obvious that the SEQUENCE of nucleotides is not caused by any physical laws of attraction between the nucleotides.
IOW: there is no physical law of attraction which causes A to come before C and for C to come before T, etc. Thus, DNA is aperiodic and its sequence is not defined by physical laws of attraction between its nucleotides, which can be in any position relative to each other. The SEQUENCE of nucleotides is not caused by any physical laws of attraction between the nucleotides.
This really isn’t a hard concept to grasp.
Furthermore, are the nucleotides not bonded to the backbone of the DNA, thus not possessing the ability to exert an attractive influence on each other to cause its own specific sequence?
CJYman:
"Actually, if you read my statement immediately before, you would have seen that I was asking what provides variation and what does the selecting in the absence of an information processor? I was asking what allows evolution of information before an information processing system exists."
smokey:
“Variation and selection IS an information processing system. It generates what YOU describe as CSI with no intelligent intervention.”
Okay, now YOUR ignorance of information processing systems is really shining through. Variation and selection can not occur without a replication/generation system and the presence of stored information and a system to retrieve and process (convert and use) that information. That system is the information processing system. You are not responding to the question that I was asking.
IOW: variation and selection can only act in the presence of previous information, an information processing system, and a replication/generation system.
CJYman:
"It is an observed and logical fact that information can not be mutated and generated apart from an information processing system."
smokey:
“The example I offered shows that you regard mere genetic variation and selection as an information processing system.”
Incorrect. The PHYSICAL MECHANISM AND ARRANGEMENT which processes the information is the information processing system.
Variation and selection may splice or change information however a type of information processing system acting on pre-existing stored information is what allows that (variation and selection) to occur.
CJYman:
"No, I didn’t accuse you of not providing genetic “details.” I accused you of not providing genetic “information” – that IS how you guys refer to a sequence of nuleotides in a segment of DNA, correct?"
smokey:
“No, we call it a sequence, and sequencing is what we do to get it.”
That’s what I just said. A sequence of nucleotides is genetic information. If you would actually read and comprehend my question, you would realize that in beginning your answer with “No” you just stated that a sequence of nucleotides is NOT genetic information. Is this correct?
Furthermore, by stating “No” to my question above, you just contradicted what you said earlier (at approx. The 17th exchange within this comment):
I said: "Nope, actually, you didn’t give me the sufficiently detailed information to calculate informational quantity. By genetic information, you do mean the sequence of nucleotides, right?"
and then you answered: “Yes! What happens to any sequence that has undergone intramolecular recombination? Has it lost or gained information?”[bold added]
So, first you say, “yes,” genetic information equals a sequence of nucleotides and then you say, “no,” genetic information is not equal to a sequence of DNA.
But then again, I somewhat understand that the above “No” could easily be in response to you thinking that I was asking if you call a sequence of DNA a “segment” of DNA, which is obviously not what I was asking if you actually read the question carefully. Is this a more accurate representation of what just occurred?
CJYman:
"Can you run that lymphocyte example by me again, while you lay out your argument that information IS defined by physical laws of attraction? I must be missing something."
smokey:
“Can't all the molecular mechanisms of VDJ recombination be explained in terms of physical laws of attraction?”
Yes, the recombination is caused by the physical laws of attraction acting on information just as the running of a computer program follows physical laws of attraction, HOWEVER as I continually keep pointing out and you continue to ignore, the INFORMATION (which is the FOUNDATION in both of these systems) which is processed in these cases IS NOT DEFINED BY PHYSICAL LAWS OF ATTRACTION BETWEEN THEIR UNITS.
This is my basic point. Life is controlled, not only by physics and chemistry, but also by complex specified information, which itself is a “non-physical-chemical principle” as stated by Michael Polanyi in “Life Transcending Physics and Chemistry,” Chemical & Engineering News (21 August 1967).
I’m pretty sure I’ve made it clear as to why information (as a FUNCTIONAL [able to be processed and used] APERIODIC CHAIN or SEQUENCE) itself transcends the attractive forces of physics and chemistry, and how the laws of physics and chemistry can merely RECOMBINE, SHUFFLE, and MUTATE PRE-EXISTING information if the physical and chemical mechanisms, switches, logic gates, etc. are arranged into a system (programmed) with the ability to process the “non-physical-chemical principle” of information.
Post a Comment